- Research article
- Open access
- Published:
Proper connectivity of Drosophila motion detector neurons requires Atonal function in progenitor cells
Neural Development volume 9, Article number: 4 (2014)
Abstract
Background
Vertebrates and invertebrates obtain visual motion information by channeling moving visual cues perceived by the retina through specific motion sensitive synaptic relays in the brain. In Drosophila, the series of synaptic relays forming the optic lobe are known as the lamina, medulla, lobula and lobula plate neuropiles. The fly’s motion detection output neurons, called the T4 and T5 cells, reside in the lobula plate. Adult optic lobe neurons are derived from larval neural progenitors in two proliferating compartments known as the outer and inner proliferation centers (OPC and IPC). Important insight has been gained into molecular mechanisms involved in the development of the lamina and medulla from the OPC, though less is known about the development of the lobula and lobula plate.
Results
Here we show that the proneural gene Atonal is expressed in a subset of IPC progenitors that give rise to the higher order motion detection neurons, T4 and T5, of the lobula plate. We also show that Atonal does not act as a proneural gene in this context. Rather, it is required specifically in IPC neural progenitors to regulate neurite outgrowth in the neuronal progeny.
Conclusions
Our findings reveal that a proneural gene is expressed in progenitors but is required for neurite development of their progeny neurons. This suggests that transcriptional programs initiated specifically in progenitors are necessary for subsequent neuronal morphogenesis.
Background
In animals, visual information is collected using photoreceptor cells, which send electrical signals to the central nervous system were the light stimulus is processed. Drosophila is a particularly well-characterized model for studying genetic mechanisms involved in neuron development and physiology. A fly’s eye is composed of 800 repetitive units called ommatidia, which collect light from the environment. Each ommatidium has eight photoreceptor neurons and twelve accessory cells. The axons of the photoreceptors reach to the optic lobe of the fly brain, where the visual information is further processed [1]. The optic lobe of a fly consists of around 60,000 cells distributed over four neuropiles: the lamina (La), medulla (Me), lobula (Lo) and lobula plate (Lop). These four neuropiles derive from two major larval optic lobe progenitor domains called the outer proliferation center (OPC) and the inner proliferation center (IPC) [2]. The mechanisms that give rise to the neural progenitors and regulate their division have been intensively investigated [2, 3]. It has been previously established that the OPC give rises to the lamina and the outer medulla and the IPC to the inner medulla, lobula and lobula plate [4, 5]. Many of the neurons that reside in the optic lobe have been characterized by Golgi impregnation [6]. They have characteristically different morphologies; however, the molecular bases that underlie these morphologies have not been established. So far, differentiation of the photoreceptor [1], lamina [7] and medulla [8] has been addressed in great detail. In contrast, specific lineage details are largely unknown for the lobula and lobula plate. For example, it is entirely unclear whether specific precursor subtypes give rise to specific neuronal subtypes, how such lineages develop and what genes regulate their development.
In both flies and mammals, the transition from neural progenitors to neurons is governed to a great extent by highly conserved transcription factors of the basic helix-loop-helix (bHLH) family, which are known as proneural proteins [9–11]. There are two major classes of proneural proteins, called the Achaete-Scute (AS) family and the Atonal (Ato) family, after their founding members. First functionally described for the Drosophila peripheral nervous system (PNS), the two types of proteins act as transcriptional activators regulating the commitment of distinct subsets of peripheral epithelial cells to neural fate [12]. Ato has been shown to be expressed in the fly optic lobe during development [10]. However, so far the nature of these cells and the function of Atonal during their development have not been addressed. In this work we show that Ato is expressed in a group of neural progenitors in the IPC that give rise exclusively to T4 and T5 lobula plate neurons, which are motion detection neurons [13]. Furthermore we find that Ato does not act as a proneural gene in this context, but instead it regulates the connectivity of T4/T5 neurons, suggesting that a transcriptional program initiated in progenitors regulates aspects of terminal differentiation in neurons.
Results
Ato is expressed in precursors of the inner optic lobe
The Drosophila larval optic lobe has been successfully used as model to study the regulation of neural differentiation [14–16], but much less is understood about the genetic control during the development of neuronal subtypes. The four neuropiles of the adult Drosophila optic lobe are formed from two populations of progenitors visible within the developing brain at the third larval instar stage (L3), the OPC and IPC. The ubiquitous epithelial marker Discs Large (Dlg) can be used to highlight the general architecture of the developing L3 nervous system (Figure 1A,B) including neuronal precursors and neuropiles [4, 17]. The highly conserved proneural transcription factor and tumor suppressor gene Ato is required for the proper development of the fly visual system. Ato mutants lack the retina and have severe defects in the optic lobes [18], largely as a non-autonomous result of the loss of retinal neurons [19]. However, in addition to its expression in the retina, previous reports noted the expression of Ato in the larval optic lobe, including expression close to the IPC [10, 18]. This suggests that ato might play an additional role in the development of the fly visual system.
To gain insight into optic lobe development and the potential function of the Ato proneural protein within it, Ato expression in the developing optic lobes was examined in further detail. The localization of Ato+ cells in the IPC (Figure 1B) suggests that they are neuronal precursors rather than neurons. To address this possibility we stained L3 brains treated with a short pulse of bromodeoxyuridine (BrdU) using Ato antibodies in order to label proliferating progenitors (Figure 1C,F). We found that Ato is co-localized with BrdU, indicating that Ato is expressed in a subset of IPC progenitors during the S phase. However, there was little overlap between Ato and the mitotic marker Phospho-Histone-H3 (PH3), suggesting that Ato is rapidly downregulated prior to progenitor cell division. On the other hand, Ato does not co-localize with the neuronal marker Embryonic lethal abnormal vision (Elav) (1G,H), indicating that it is not expressed in neurons. In summary, Ato marks a subset of progenitors in the developing Drosophila optic lobes.
We sought to identify the lineage of Ato+ progenitors and investigate the role of ato in inner optic lobe development. We generated an IPC-specific ato-Gal4 driver line that is not expressed in the retina. We have previously described an ato-LacZ reporter line, which mimics ato expression in the L3 brain but not in the eye imaginal disc [10]. This LacZ reporter is expressed in the same cells as the Ato protein and its expression lasts longer due to the stability of the β-Gal protein. A similar, but slightly shorter version of this enhancer was used first to generate a direct GFP fusion reporter line to ascertain that it labels the same Ato+ lineage. The enhancer was then used to generate an ato-Gal4 driver specific to the IPC (Figure 2A), which henceforth will be referred to as IPC-Gal4 or the IPC driver. The overlap between Ato, IPC-GFP, ato-LacZ and IPC-Gal4 shows that these two enhancers identify the same population of cells (Figure 2B,C,D,E,G). The green fluorescent protein (GFP) is known to be highly stable. Expression of GFP using IPC-Gal4 marks the derivatives of the Ato+ progenitors and it was only present in some precursors, presumably the oldest pool, due to the delay in GFP expression and the stability of GFP (Figure 2F,G, green). During the L3 stage, the progeny of Ato+ cells move towards the center of the IPC, where they differentiate into neurons as demonstrated by co-localization of the pan-neuronal markers Elav and GFP (Figure 2H,I). Finally, a LexA knock-in into the Ato locus [20] also co-localizes with IPC-Gal4-driven GFP at the border of the cluster, presumably the oldest pool of Ato+ progenitors (Additional file 1: Figure S1). In summary, Ato+ progenitors in the IPC generate a neuron population resident in the optic lobe.
Atonal progenitors give rise exclusively to motion detection T4 and T5 neurons
Next, we analyzed the expression of IPC-Gal4 throughout development (Figure 3), to trace the Ato lineage. During pupal development, neurons generated from Ato+ precursors become localized in the posterior part of the optic lobe in the Lop. This can also be clearly seen in confocal horizontal sections through an adult fly brain (Figure 3F). Thus Ato+ progenitors give rise to a group of neurons that populate the rear of the Lop.
It has been shown that the posterior cortex of the Lop contains three major neuronal subtypes, called T4/T5, the translobula plate (Tlp) and Y. T4 and T5 neurons are characterized by their peculiar looping trajectory. They project through the Lop towards the proximal Me (T4) or proximal Lo (T5) where they form a dendritic arborization. They then turn 180° to project back towards the Lop where they form axonal endings. The other two classes, Tlp and Y, form dendritic arbors in the Lop, and axonal terminations in the Lo (Tlp) and proximal Me (Y) [6]. We sought to determine which specific Lop neurons originate from Ato+ progenitors. We used the flybow technique, which is used to mark stochastically clones of cells with different fluorescent proteins [21]. Using this approach with IPC-Gal4 and examining multi- and single-cell clones, we found only two populations of neurons, one sending projections towards the inner medulla and the other towards the lobula (Figure 3G,G',G''). The morphology observed resembles the T4 and T5 neurons described previously [6] and recently found to be essential components of the motion detection circuit [22, 23]. Based on the morphology shown by silver staining, it has been proposed that dendrites of these neurons project towards the Lo (T5) and Me (T4) while their axons project within the Lop. To confirm this, we used subcellular markers to determine which projections correspond to dendrites and axons (Figure 3H,H',H''). Consistent with the Ato+ derived neurons being T4 and T5, we find that the dendritic marker DenMark [24] localize in the projections targeting the proximal layers of medulla and lobula, respectively, whereas the presynaptic vesicle marker Syt-GFP labels the projections in the Lop. In summary, Ato+ progenitors give rise mostly or exclusively to T4/T5 neurons, although an additional small minority population that escapes clonal labeling cannot be ruled out at this stage.
Atonal does not act as a proneural gene in the optic lobe but is required for neurite guidance
To address the role of ato in optic lobe development, we examined the neuronal progeny of Ato+ precursors in ato mutant animals using two independent mutant alleles: the ato1 mutant [18] and a knock-in of the white gene in the ato locus [25]. One copy of ato is sufficient to form a phenotypically wild-type optic lobe, therefore ato/+ animals were used as controls. In the PNS, loss of ato results in the complete loss of sensory precursors and thus the sensory lineages derived from them [18, 26]. We found that in the IPC, however, Ato is not required to generate optic lobe neurons, since in the absence of ato, the Ato+ precursors still gave rise to neurons. The pan-neuronal marker Elav remained almost completely co-localized with the GFP+ cells as in wild-type L3 brains (Additional file 2: Figure S2). Moreover we observed that the area of the neuronal cluster is comparable between mutant and control animals (Additional file 2: Figure S2C). This indicates that ato does not act as a proneural gene in the optic lobe in contrast with its function in PNS progenitors.
To further investigate if Ato is required for the development of T4/T5 development, we examined their projection pattern in L3 and adult stages. In developing T4/T5 neurons, the neurites form a radial arrangement around the cell body cluster (Figure 4A). In contrast, in ato mutants neurites lose this organization, showing over fasciculation, guidance and growth defects (Figure 4B, Table 1). We observed a similar phenotype in the optic lobe of adult animals where dendrites have clear fasciculation and overgrowth defects (Figure 4C,D,D'). However, in full ato mutants the retina and La were completely absent and the Me and Lop neuropiles were markedly reduced in size, as can be appreciated by comparing wild-type with mutant flies. It has been previously established that the retina is required for neurogenesis in the larval optic lobes [19] and as such optic lobe defects and T4/T5 defects in ato mutants may be a consequence of the loss of the retina. To test this, we generated animals in which most of the retina was absent in an otherwise wild-type background by expressing the cell death gene hid with the eye-specific Glass multiple reporter (GMR) promoter during eye development (Additional file 3: Figure S3A,B,B'). This resulted in essentially the complete loss of the La (Additional file 3: Figure S3B,B'). In addition, the Me appeared reduced in size, while the size and overall organization of the Lo and Lop appeared significantly better. Specifically, the general organization of the T4/T5 neurons was largely unaffected in contrast to the ato mutant brains where the T4/T5 neurons were disorganized. This suggests that T4/T5 defects observed in ato mutants may be specifically due to loss of Ato in the IPC. To confirm this, we generated MARCM [27] clones using the ato1 allele (Figure 4E-F', Table 1) and analyzed the T4/T5 neurons at the L3 stage. We observed similar phenotypes to the ones seen in the whole mutant, where the neurites over fasciculate and are misguided and there is some overgrowth towards the central brain, further confirming that Atonal is required in the IPC for normal T4/T5 development.
In summary, Ato does not act as a proneural factor in T4/T5 precursors. Instead, neurons still develop in the mutant, but have neurite connectivity defects.
Discussion
Atonal and the insect visual circuit
Transcription factors of the Atonal family have previously been shown to act as proneural genes in many cellular contexts [28–30]. In the Drosophila visual system, Ato is the proneural gene for photoreceptor cells [18]. Interestingly, Ato also regulates indirectly the development of the optic lobe through the patterning of the retina and it is expressed during larval life in other populations of postmitotic optic lobe neurons, namely the dorsal cluster neurons and several clusters of neurons located ventrally in the brain [10]. In this work, we found that the development of T4/T5 neurons, essential components of the motion detection system, is also Ato dependent. Taken together these observations indicate that Ato underlies the patterning of the visual system at many different levels. We speculate that this may reflect a basal state of the invertebrate visual system in which an ancestral Ato-like proneural gene may have instructed the formation of all neural components in the visual system.
A progenitor program regulates neurite guidance of neuronal progeny
In this work we identified a novel subset of Drosophila neural precursors where the proneural gene is required for the proper differentiation of the lineage. This is similar to previous observations in mammals. For example, mice mutant for the Neurogenin-2 proneural factor do not lack cortical neural stem cells but instead generate fewer neurons and these migrate and have neurite outgrowth defects [31, 32], although in this case transient Ngn2 expression in postmitotic neurons has been observed [32].
The loss-of-function phenotype of Ato in IPC progenitors suggests two possible explanations. On the one hand, neural progenitors may initiate a transcriptional program prior to their division that is then required in their progeny for correct neurite targeting, implicating a cell autonomous function of Ato targets in the neurons. This may indicate that, as for the retina [33], the transcriptional program downstream of Ato in IPC progenitors regulates multiple aspects of lineage differentiation and likely the loss of several targets genes causes these defects. On the other hand, it is possible that the progenitors guide T4/T5 neurites during development and then the loss of function of Ato in the progenitors could affect, for instance, the expression of guidance molecules, indicating a non-autonomous mechanism. Future analysis of the Ato targetome in tissue-specific contexts will address these questions.
Conclusions
Here we identified a proneural gene that is expressed in progenitors but is required for the guidance of their neuronal progeny. This suggests that transcriptional programs initiated specifically in progenitors are necessary for subsequent neuronal morphogenesis. These programs can act in two ways: either through the activation of a transcriptional cascade that survives cell division, or through direct guidance of neuronal processes by the progenitor cells themselves, through the expression or secretion of guidance factors.
Methods
Fly strains and genetic manipulation
Fly stocks were cultured on standard fly food. All experiments were performed in temperature-controlled incubators at 25°C or 28°C. The fly strains used were: CS10; ato1/TM6c; atow/ TM6c; IPC(F1-R3)-Gal4, UAS-nEGFP and IPC(F1-R3)-Gal4, UAS-nEGFP;ato1, FRT82B/TM6b, IPC-EGFP and Ato-LexA, lexAop-TLNΔ-Cherry for expression pattern and mutant analysis (in this case the leakage of the nEGFP from the nucleus allowed us to examine the neurites).
For the MARCM experiments, females with the genotype hsFlp, UAS::CD8::GFP;;tub-Gal80, FRT82B/TM6c were crossed with males IPC(F1-R3)-Gal4,UAS-nEGFP; ato1, FRT82B/TM6c or males IPC(F1-R3)-Gal4,UAS-nEGFP; FRT82B/TM6c (control) A 1-hr heat shock at 37°C was applied to the second instar larvae to induce mitotic recombination.
For the flybow experiments, UAS-Flp; hs-mFlp5 stock was crossed with UAS-Flybow2.0; IPC-Gal4 stock. A 1-hr heat shock at 37°C was applied to the third instar larvae (96 After egg lagging). The animals were dissected as late pupae (80% to 90%).
For dendritic-axon compartment analysis, flies tub < STOP > Gal4; IPC-Gal4/TM6c were crossed with the stock UAS-Flp; UAS-DenMark, UAS-Syt::GFP (tub < STOP > Gal4 and UAS-Flp were used to prolong the expression of IPC-Gal4, which is not strong in the adult stage).
For the eye ablation experiments, GMR-hid flies were crossed with IPC(F1-R3)-Gal4, UAS-nEGFP flies.
Antibody staining
For antibody staining, adult and larval brains were dissected in PBS and fixed in PBT 4% formaldehyde for 15 to 20 min. Fixed brains were washed three times for 15 to 20 min in PBT and incubated with the PAXDG buffer (PBT, 5% normal goat serum, 1% BSA, 0.3% deoxycholate) or PBT-BSA1% (for Ato antibodies), for 30 min to 1 hr at room temperature. Primary antibody incubation was done in PAXDG overnight at 4°C. Then the samples were washed three times with PBT and incubated with the appropriate secondary antibody in PAXDG for 2 to 4 hr, washed with PBT and mounted using the Vectashield mounting medium (Vector, Burlingame, CA, USA). The following antibodies were obtained from the Developmental Studies Hybridoma Bank (DSHB, Iowa city, IA, USA): rat anti-Elav (1:20), mouse anti-Bruchpilot (nc82 1:100), rat anti NCad (1:10) and mouse anti-Dlg (1:100). Other antibodies used were: sheep anti-Ato (1:1000), rabbit anti-Phospho-Histone-3 (Millipore, Billerica, MA, USA, 1:500), mouse anti-GFP 3E6 (Invitrogen, catalog number A11120, 1:250), rabbit anti-GFP (Invitrogen, Carlsbad, CA, USA, catalog number A11122, 1:500) and rabbit anti-DsRed (Clontech, Mountain View, CA, USA, catalog number 632496; 1:500). Secondary antibodies conjugated with Alexa 488, Alexa 555 and Alexa 647 were obtained from Invitrogen and used at 1:500. For the BrdU incorporation experiments, larval tissues were incubated in PBS with 75 μg/ml BrdU for 15 min, fixed and treated in 3 M HCl for 30 min before incubation with primary antibodies [34].
Imaging
Imaging was performed using a Nikon A1-R confocal (Nikon, Tokyo, Japan) mounted on a Nikon Ti-2000 inverted microscope (Nikon) and equipped with 405-, 488-, 561- and 639-nm lasers from Melles Griotconfocal. Images were processed using the ImageJ software (National Institutes of Health, Bethesda, MD, USA). Figures were prepared using Adobe Photoshop (Adobe, San Jose, CA, USA). Cell clusters were quantified using the particle analysis tool of ImageJ.
Statistics
Statistical analysis was performed using the Prism software (GraphPad Software Inc, La Jolla, CA, USA). A two-tailed t-test was used for two-group comparisons.
IPC-GFP and IPC-Gal4
To generate IPC-Gal4, a sequence of 838 bp localized upstream of the ato locus (positions -5046 and -4209) was amplified by PCR using the primers:
Fw-Xba-I-IPC: TCTAGAGGATGGGATTAGGGATAAGG
Rv-Bgl-II-IPC: AGATCTGAATGGAGTTGGCCACAATGG
The amplified fragment was cloned in the Xba-I and Bgl-II restriction sites in the pPT-Gal4 vector.
For the IPC-GFP direct fusion, the IPC enhancer was cloned together with the Tata box of the pPT-Gal4 vector and an EGFP open reading frame in a modified pUAST vector. The UAS binding sites were deleted and an AttB site was added to allow PhiC31-mediated integration.
Transgenic flies were generated using standard methods.
Abbreviations
- APF:
-
After pupal formation
- AS:
-
Achaete-Scute
- Ato:
-
Atonal
- bHLH:
-
basic helix-loop-helix
- BrdU:
-
bromodeoxyuridine
- BSA:
-
bovine serum albumin
- Dlg:
-
Disc Large
- Elav:
-
Embryonic lethal abnormal vision
- GFP:
-
Green fluorescent protein
- GMR:
-
Glass multiple reporter
- EGFP:
-
enhanced GFP IPC, inner proliferation center
- L3:
-
third instar larvae
- La:
-
lamina
- Lo:
-
lobula
- Lop:
-
lobula plate
- MARCM:
-
mosaic analysis with a repressible cell marker
- Me:
-
medulla
- nEGFP:
-
nuclear EGFP
- OPC:
-
outer proliferation center
- PBS:
-
phosphate-buffered saline
- PBT:
-
PBS plus 0,3% triton X100
- PCR:
-
polymerase chain reaction
- Ph3:
-
Phospho-Histone-H3
- PNS:
-
peripheral nervous system
- Syt:
-
Synaptotagmin
- Tlp:
-
translobula plate
- UAS:
-
Upstream Activating Sequence.
References
Quan XJ, Ramaekers A, Hassan BA: Transcriptional control of cell fate specification: lessons from the fly retina. Curr Top Dev Biol. 2012, 98: 259-276.
Egger B, Gold KS, Brand AH: Regulating the balance between symmetric and asymmetric stem cell division in the developing brain. Fly. 2011, 5: 237-241. 10.4161/fly.5.3.15640.
Knoblich JA: Mechanisms of asymmetric stem cell division. Cell. 2008, 132: 583-597. 10.1016/j.cell.2008.02.007.
Egger B, Boone JQ, Stevens NR, Brand AH, Doe CQ: Regulation of spindle orientation and neural stem cell fate in the Drosophila optic lobe. Neural Dev. 2007, 2: 1-10.1186/1749-8104-2-1.
Hofbauer A, Campos-Ortega JA: Proliferation pattern and early differentiation of the optic lobes in Drosophila melanogaster. Rouxs Arch Dev Biol. 1990, 198: 264-274. 10.1007/BF00377393.
Fischbach KF, Dittrich APM: The optic lobe of Drosophila melanogaster, I. A Golgi analysis of wild-type structure. Cell Tissue Res. 1989, 258: 441-475.
Umetsu D, Murakami S, Sato M, Tabata T: The highly ordered assembly of retinal axons and their synaptic partners is regulated by Hedgehog/Single-minded in the Drosophila visual system. Development. 2006, 133: 791-800. 10.1242/dev.02253.
Li X, Erclik T, Bertet C, Chen Z, Voutev R, Venkatesh S, Morante J, Celik A, Desplan C: Temporal patterning of Drosophila medulla neuroblasts controls neural fates. Nature. 2013, 498: 456-462. 10.1038/nature12319.
Bertrand N, Castro DS, Guillemot F: Proneural genes and the specification of neural cell types. Nat Rev Neurosci. 2002, 3: 517-530. 10.1038/nrn874.
Hassan BA, Bermingham NA, He Y, Sun Y, Jan YN, Zoghbi HY, Bellen HJ: Atonal regulates neurite arborization but does not act as a proneural gene in the Drosophila brain. Neuron. 2000, 25: 549-561. 10.1016/S0896-6273(00)81059-4.
Powell LM, Jarman AP: Context dependence of proneural bHLH proteins. Curr Opin Genet Devel. 2008, 18: 411-417. 10.1016/j.gde.2008.07.012.
Quan XJ, Hassan BA: From skin to nerve: flies, vertebrates and the first helix. Cellular Mole Life Sci. 2005, 62: 2036-2049. 10.1007/s00018-005-5124-1.
Maisak MS, Haag J, Ammer G, Serbe E, Meier M, Leonhardt A, Schilling T, Bahl A, Rubin GM, Nern A, Dickson BJ, Reiff DF, Hopp E, Borst A: A directional tuning map of Drosophila elementary motion detectors. Nature. 2013, 500: 212-216. 10.1038/nature12320.
Egger B, Gold KS, Brand AH: Notch regulates the switch from symmetric to asymmetric neural stem cell division in the Drosophila optic lobe. Development. 2010, 137: 2981-2987. 10.1242/dev.051250.
Yasugi T, Umetsu D, Murakami S, Sato M, Tabata T: Drosophila optic lobe neuroblasts triggered by a wave of proneural gene expression that is negatively regulated by JAK/STAT. Development. 2008, 135: 1471-1480. 10.1242/dev.019117.
Morante J, Erclik T, Desplan C: Cell migration in Drosophila optic lobe neurons is controlled by eyeless/Pax6. Development. 2011, 138: 687-693. 10.1242/dev.056069.
Albornoz V, Mendoza-Topaz C, Oliva C, Tello J, Olguin P, Sierralta J: Temporal and spatial expression of Drosophila DLGS97 during neural development. Gene Expr Patterns. 2008, 8: 443-451. 10.1016/j.gep.2008.04.001.
Jarman AP, Grell EH, Ackerman L, Jan LY, Jan YN: Atonal is the proneural gene for Drosophila photoreceptors. Nature. 1994, 369: 398-400. 10.1038/369398a0.
Huang Z, Kunes S: Hedgehog, transmitted along retinal axons, triggers neurogenesis in the developing visual centers of the Drosophila brain. Cell. 1996, 86: 411-422. 10.1016/S0092-8674(00)80114-2.
Langen M, Koch M, Yan J, De Geest N, Erfurth ML, Pfeiffer BD, Schmucker D, Moreau Y, Hassan BA: Mutual inhibition among postmitotic neurons regulates robustness of brain wiring in Drosophila. eLife. 2013, 2: e00337-10.7554/eLife.00337.
Hadjieconomou D, Rotkopf S, Alexandre C, Bell DM, Dickson BJ, Salecker I: Flybow: genetic multicolor cell labeling for neural circuit analysis in Drosophila melanogaster. Nat Methods. 2011, 8: 260-266. 10.1038/nmeth.1567.
Borst A: Drosophila's view on insect vision. Curr Biol. 2009, 19: R36-R47. 10.1016/j.cub.2008.11.001.
Schnell B, Raghu SV, Nern A, Borst A: Columnar cells necessary for motion responses of wide-field visual interneurons in Drosophila. J Comparative Physiol A, Neuroethol Sensory Neural Behavioral Physiol. 2012, 198: 389-395. 10.1007/s00359-012-0716-3.
Nicolai LJ, Ramaekers A, Raemaekers T, Drozdzecki A, Mauss AS, Yan J, Landgraf M, Annaert W, Hassan BA: Genetically encoded dendritic marker sheds light on neuronal connectivity in Drosophila. Proc Natl Acad Sci USA. 2010, 107: 20553-20558. 10.1073/pnas.1010198107.
Choi CM, Vilain S, Langen M, Van Kelst S, De Geest N, Yan J, Verstreken P, Hassan BA: Conditional mutagenesis in Drosophila. Science. 2009, 324: 54-10.1126/science.1168275.
Jarman AP, Grau Y, Jan LY, Jan YN: Atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system. Cell. 1993, 73: 1307-1321. 10.1016/0092-8674(93)90358-W.
Lee T, Luo L: Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron. 1999, 22: 451-461. 10.1016/S0896-6273(00)80701-1.
Bermingham NA, Hassan BA, Price SD, Vollrath MA, Ben-Arie N, Eatock RA, Bellen HJ, Lysakowski A, Zoghbi HY: Math1: an essential gene for the generation of inner ear hair cells. Science. 1999, 284: 1837-1841. 10.1126/science.284.5421.1837.
Jarman AP, Sun Y, Jan LY, Jan YN: Role of the proneural gene, atonal, in formation of Drosophila chordotonal organs and photoreceptors. Development. 1995, 121: 2019-2030.
Jhaveri D, Sen A, Reddy GV, Rodrigues V: Sense organ identity in the Drosophila antenna is specified by the expression of the proneural gene atonal. Mech Dev. 2000, 99: 101-111. 10.1016/S0925-4773(00)00487-1.
Schuurmans C, Armant O, Nieto M, Stenman JM, Britz O, Klenin N, Brown C, Langevin LM, Seibt J, Tang H, Cunningham JM, Dyck R, Walsh C, Campbell K, Polleux F, Guillemot F: Sequential phases of cortical specification involve Neurogenin-dependent and -independent pathways. EMBO J. 2004, 23: 2892-2902. 10.1038/sj.emboj.7600278.
Hand R, Bortone D, Mattar P, Nguyen L, Heng JI, Guerrier S, Boutt E, Peters E, Barnes AP, Parras C, Schuurmans C, Guillemot F, Polleux F: Phosphorylation of Neurogenin2 specifies the migration properties and the dendritic morphology of pyramidal neurons in the neocortex. Neuron. 2005, 48: 45-62. 10.1016/j.neuron.2005.08.032.
Aerts S, Quan XJ, Claeys A, Naval Sanchez M, Tate P, Yan J, Hassan BA: Robust target gene discovery through transcriptome perturbations and genome-wide enhancer predictions in Drosophila uncovers a regulatory basis for sensory specification. PLoS biology. 2010, 8: e1000435-10.1371/journal.pbio.1000435.
Wolff T: Histological techniques for the Drosophila eye. Part I: Larva and pupa. Drosophila Protocols. Edited by: Sullivan W, Ashburner M, Hawley RS. 2000, New York: Cold Spring Harbor Laboratory Press, 201-227.
Acknowledgements
We thank A. Jarman for providing the Atonal antibody, and GM Rubin, C Goodman, E Buchner for generating the DSHB antibodies used in this study. This work was supported by VIB, the WiBrain Interuniversity Attraction Pole (BELSPO IUAP) network, and Fonds Wetenschappelijke Onderzoeks (FWO) through grants G.0543.08, G.0680.10, G.0681.10 and G.0503.12 (to BAH) as well a postdoctoral fellowship from Becas Chile (to CO) and an Innovatie door Wetenschap en Technologie (IWT) doctoral fellowship (to LJJN).
Author information
Authors and Affiliations
Corresponding author
Additional information
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
CO and CMC conceived and designed the study, collected and analyzed the data, wrote the manuscript and gave final approval for the manuscript. LJJN and NM collected and analyzed the data, and gave final approval for the manuscript. NDG carried out the cloning and provided technical assistance. BAH conceived and designed the study, participated in the coordination of the study, wrote the manuscript and gave final approval for the manuscript. All authors read and approved the final manuscript.
Carlos Oliva, Ching-Man Choi contributed equally to this work.
Electronic supplementary material
13064_2013_249_MOESM1_ESM.tif
Additional file 1: Figure S1: Relation between Ato promoter and the IPC enhancer. (A,B) Immunostaining in the L3 stage. (A) The LexA transcription factor, a knock-in in the ato locus, which drives TLNΔ-Cherry, is used to highlight the whole Ato lineage. There is co-localization with IPC-Gal4 at the border of the cluster (B) indicating that they coexist in some progenitors. Scale bar: A,B = 20 μm. (TIF 2 MB)
13064_2013_249_MOESM2_ESM.tif
Additional file 2: Figure S2: Neurons still develop in absence of Ato. (A-B') Immunostaining of wild-type and atowL3 cells showing that in the mutants Ato+ progenitors (green) still give rise to Elav+ neurons (magenta). (A,A') Control animal bearing IPC-Gal4, UAS-nEGFP transgenes. (B,B') atowmutant animals still express Elav in the cells originating from Ato+ precursors indicating that they are still neurons. (C) Quantification of the area of the IPC neuronal cluster in controls and atowanimals. There were no significant differences in the size of the cluster among the genotypes (two-tailed t-test, P = 0.8379). Scale bar: A-B' = 20 μm. (TIF 9 MB)
13064_2013_249_MOESM3_ESM.tif
Additional file 3: Figure S3: T4/T5 dendritic pattern is not disturbed when there is no retina. (A) Wild-type adult animal bearing IPC-Gal4, UAS-nEGFP. (A') Close-up showing the dendritic projections of the T4/T5 neurons. (B) Flies with no eyes because of expression of the pro-apoptotic gene hid using the GMR promoter. The dotted line in (B) marks the border between the lobula complex and the medulla. (B') Close-up showing the dendritic projections of the T4/T5 neurons in this condition. The neuropiles are smaller than the control but cell bodies and dendrites of the T4/T5 neurons have a wild-type appearance. Scale bars: A,B = 50 μm, A',B' = 25 μm. (TIF 10 MB)
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( https://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Oliva, C., Choi, CM., Nicolai, L.J.J. et al. Proper connectivity of Drosophila motion detector neurons requires Atonal function in progenitor cells. Neural Dev 9, 4 (2014). https://doi.org/10.1186/1749-8104-9-4
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/1749-8104-9-4