Skip to main content

E-proteins orchestrate the progression of neural stem cell differentiation in the postnatal forebrain

Abstract

Background

Neural stem cell (NSC) differentiation is a complex multistep process that persists in specific regions of the postnatal forebrain and requires tight regulation throughout life. The transcriptional control of NSC proliferation and specification involves Class II (proneural) and Class V (Id1-4) basic helix-loop-helix (bHLH) proteins. In this study, we analyzed the pattern of expression of their dimerization partners, Class I bHLH proteins (E-proteins), and explored their putative role in orchestrating postnatal subventricular zone (SVZ) neurogenesis.

Results

Overexpression of a dominant-negative form of the E-protein E47 (dnE47) confirmed a crucial role for bHLH transcriptional networks in postnatal neurogenesis by dramatically blocking SVZ NSC differentiation. In situ hybridization was used in combination with RT-qPCR to measure and compare the level of expression of E-protein transcripts (E2-2, E2A, and HEB) in the neonatal and adult SVZ as well as in magnetic affinity cell sorted progenitor cells and neuroblasts. Our results evidence that E-protein transcripts, in particular E2-2 and E2A, are enriched in the postnatal SVZ with expression levels increasing as cells engage towards neuronal differentiation. To investigate the role of E-proteins in orchestrating lineage progression, both in vitro and in vivo gain-of-function and loss-of-function experiments were performed for individual E-proteins. Overexpression of E2-2 and E2A promoted SVZ neurogenesis by enhancing not only radial glial cell differentiation but also cell cycle exit of their progeny. Conversely, knock-down by shRNA electroporation resulted in opposite effects. Manipulation of E-proteins and/or Ascl1 in SVZ NSC cultures indicated that those effects were Ascl1 dependent, although they could not solely be attributed to an Ascl1-induced switch from promoting cell proliferation to triggering cell cycle arrest and differentiation.

Conclusions

In contrast to former concepts, suggesting ubiquitous expression and subsidiary function for E-proteins to foster postnatal neurogenesis, this work unveils E-proteins as being active players in the orchestration of postnatal SVZ neurogenesis.

Background

The self-renewal versus differentiation of neural stem cells (NSCs) into new neurons is a highly complex process and depends on tight regulatory mechanisms throughout postnatal life. Early after birth, radial glia cells (RGCs) mature into type-B cells that reside in the germinal niche lining the lateral ventricles (LVs), namely the subventricular zone (SVZ). These NSCs proliferate slowly (infrequently) and by asymmetric division give rise to fast proliferating cells, defined as type-C cells (or transit amplifying progenitors). After 3 to 4 cycles of symmetric divisions, allowing the pool of type-C cells to enlarge, these progenitors start to differentiate and commit to specific fates [1]. At this stage, they are defined as type-A cells (or neuroblasts), which then migrate through the rostral migratory stream (RMS) into the olfactory bulb [2, 3] to terminally differentiate into specific neuron subtypes (i.e., periglomerular neurons and granule cells) [4].

To balance NSC maintenance and precursor differentiation into neurons or glial cells, postnatal neurogenesis relies on the timely integration of intracellular signaling mechanisms such as the basic-helix-loop-helix (bHLH) transcription factor machinery. bHLH proteins represent a large family of transcription factors that are categorized in several classes based on their structure and function [5] and are believed to play an essential role in multiple aspects of forebrain development. By virtue of their transcriptional activity, bHLH proteins can be subdivided into three groups, i.e., activators (Class II), repressors (Class V), and transactivators (Class I) [6].

The classical view of bHLH protein interaction and function is still largely based on drosophila studies [7–9] and murine developmental studies [5, 10–12]. There, bHLH repressors (i.e., Hes and Id proteins) and activators (proneural proteins, i.e., Ascl1, Neurog2) mutually antagonize each other either by direct transcriptional repression [13, 14], physical inhibition [8, 15], or by competing for bHLH transactivators (E-proteins) [12, 16]. This antagonistic balance defines whether NSCs or their progeny are differentiating or not, with bHLH repressors predominantly favoring the retention of cells in immature stages [17, 18], while bHLH activators accelerate progenitor maturation [13, 14, 19–22].

Recent work done in drosophila, however, indicates that this established paradigm is likely to be over-simplified and incomplete. A more sophisticated spatial and temporal regulation of E-protein expression has been proposed, suggesting that E-proteins (E2-2, E2A, HEB) fulfill a more complex function than anticipated in germinal zones of the central nervous system (CNS) [23, 24]. Furthermore, work in rodents implies that various E-proteins exhibit differential patterns of expression at distinct ages, resulting in the preferential formation of specific dimers [25–27].

This complex pattern of expression, paired with a recent study implicating Ascl1 in regulating both NSC proliferation and differentiation [22], suggests that E-proteins orchestrate NSC lineage progression, a hypothesis we examine in the present study.

Results

Heterodimerization of Class I/II bHLH proteins is essential for normal NSC differentiation in vitro and in vivo

NS5 cell cultures contain homogenous populations of progenitors that divide indefinitely upon exposure to FGF2 and EGF and undergo neuronal and glial differentiation following mitogen withdrawal [28]. Overexpression of proneural proteins, such as Ascl1, in progenitors of various origins results in their rapid neuronal differentiation [19–22].

In the first instance, the role of Class I/II bHLH factors in mediating neurogenesis was assessed in vitro. The efficiency of neuronal differentiation following overexpression of Ascl1 alone or in combination with E-proteins when NS5 cells were grown in proliferative culture conditions was determined. Overexpression of Ascl1 induced a >3-fold increase in neuronal differentiation compared to an empty control plasmid, as revealed by elevated Map2 or CD24 transcript expression, both of which are immature neuron markers (Figure 1A). Cotransfection of Ascl1 with either E-protein, i.e., E2-2, E47 (E2A isoform), and HEB, further potentiated Ascl1-induced neuronal differentiation by approximately 50 to 80% when Map2 expression was measured, and to a lesser extent when CD24 transcription was probed (Figure 1A). In contrast, measurement of ABCG2, a transcript expressed in NSCs, showed opposite trends (Figure 1A). Together, these results illustrate the interchangeability of E-proteins in this cellular context and their potential to promote Ascl1-induced NS5 cell differentiation.

Figure 1
figure 1

In vitro and in vivo modulation of bHLH function regulates neurogenesis. (A) Ascl1 nucleofection in NS5 cells caused an increased Map2 and CD24 expression whilst conversely decreasing ABCG2 mRNA expression, as detected via RT-qPCR (100 ± 19.1 vs. 299.4 ± 8.4, 100 ± 19.6 vs. 392.1 ± 46.1, 100 ± 15.2 vs. 43.8 ± 2.5, respectively). Additionally, all E-proteins (E2-2, E47, HEB) further potentiated Ascl1-induced alteration in marker expression, when co-nucleofected with Ascl1 (Map2: 299.4 ± 8.4 vs. 349 ± 21.2, 345.7 ± 10, 378.3 ± 21; CD24: 392.1 ± 46.1 vs. 423.3 ± 39.7, 508.5 ± 40.2, 426.4 ± 11.7; ABCG2: 43.8 ± 2.5 vs. 35.7 ± 2.9, 29.7 ± 0.5, 38.8 ± 0.6, respectively). (B) Schematic illustration of the dominant-negative construct of E47 (dnE47), where the nuclear localization sequence is missing, therefore preventing its nuclear translocation and transcriptional activity of its dimerizing partners (F, insert). (C) Co-nucleofection of dnE47 reduced Ascl1-induced neurogenesis as revealed by Map2 RT-qPCR measurements (100 ± 4.2 vs. 66.8 ± 8.5). (D, E) Targeted in vivo electroporation of the dnE47-RFP construct rapidly reduced RGC differentiation, as revealed by the lower proportion of non-RGCs, when compared to an empty RFP control plasmid (100 ± 5.5 vs. 12.6 ± 2.7) 2 days post-electroporation. (F) Cycling progenitors (non-RGC) were maintained proliferating (Ki67+) following dnE47 induction (100 ± 9.6 vs. 182 ± 9.6). P values: *P <0.05; **P <0.01; ***P <0.001. All quantifications were normalized to control conditions. Scale bars: D, 20 μm.

We next disrupted Class I/II bHLH transcriptional activity in vitro and in vivo to investigate its effect on NSC differentiation. We used a mutated form of the E2A isoform E47, which lacks its nuclear localization sequence and fails to translocate to the cell nucleus, and therefore sequesters its binding partners within the cytoplasm [29, 30] (Figure 1B,D (insert)). While overexpression of dominant-negative E47 (dnE47) alone did not influence Map2 transcript expression in proliferative culture conditions (Additional file 1A), it efficiently prevented Ascl1-induced neuronal differentiation of NS5 cells as shown by the partial blockade of Map2 induction (Figure 1C). We next tested the effect of dnE47 in SVZ NSCs (i.e., radial glia cells (RGCs) at this early postnatal stage) by performing postnatal in vivo electroporation. Early after birth, NSCs can be easily distinguished from their progeny based on morphological criteria, i.e., an elongated cell body and the presence of a basal and apical process [31, 32]. Quantification revealed a dramatic blockade of differentiation following dnE47 overexpression, with most electroporated RFP+ cells still presenting a clear RGC morphology (Figure 1D,E). Interestingly, cells that were already undergoing differentiation into non-radial glial cells (non-RGCs) exhibited an enhanced proliferative phenotype, as demonstrated by the doubling of the number of Ki67+/RFP+ non-RGCs (Figure 1F, Additional file 1B).

To confirm the accuracy in monitoring RGC differentiation progression by electroporation and analysis of morphological criteria, we next performed an in depth antigenic characterization of RGCs and non-RGCs. At 2 days post-electroporation (2 dpe), RGCs were highly positive for type-B cell markers (i.e., Vimentin and Hes5-EGFP) and completely devoid of the type-C cell marker Ascl1 (Figure 2A,B). In contrast, non-RGCs were characterized as a mix of type-C (Ascl1+, 50%) and type-A (Dcx+, 50%) progenitors (Figure 2A,B). Approximately half of the non-RGCs were proliferating, as indicated by expression of Ki67 (Figure 2B). Those proliferating cells were mostly Ascl1+ type-C cells (~60%, Figure 2C, Additional file 1C), while only ~25% expressed the type-A cell marker Dcx (Figure 2C, Additional file 1D). Interestingly, ~10% of proliferating non-RGCs exhibited a transitory phenotype between type-C and type-A cell stages and were positive for both markers (Ascl1+Dcx+; Figure 2C).

Figure 2
figure 2

Antigenic properties of radial glial as well as non-radial glial cells and confirmation of differentiation blockade by dnE47 overexpression. (A, B), At 2 days post electroporation (dpe), 40% of the labeled cells showed morphological criteria of radial glial cells (RGCs, i.e., bipolar processes, apical connection to lateral ventricle (LV) lumen), while 60% presenting a spherical morphology were distant from the LV and were defined as non-RGCs. Morphologically-defined RGCs express the NSC marker Vimentin (88.4 ± 0.7) and were EGFP positive in Hes5-EGFP reporter mice (94.2 ± 2.4), but negative in Ascl1-EGFP reporter mice, in which type-B or type-C cells are labelled, respectively [33, 34]. In contrast, non-RGCs consisted of a heterogeneous population of type-C (i.e., Ascl1+, 53.6 ± 4.3) and type-A cells (i.e., Dcx+, 45.9 ± 0.2). Non-RGCs were frequently proliferative (i.e., Ki67+, 58.2 ± 5.7). (C) A subsequent characterization of cycling non-RGCs revealed that most Ki67+ cells were type-C cells (Ascl1+, 60.1 ± 4.4), whereas fewer were type-A cells (Dcx+, 22.9 ± 4.0). Notably, a minor population of cycling cells were double-positive for Ascl1 and Dcx (10.1 ± 1.4), probably representing a transition phase in between type-C and type-A phenotypes. (D–G) Antigenic assessment of RGC differentiation blockade following dnE47 overexpression. Electroporation of dnE47 in the postnatal SVZ reduced RGC differentiation, as revealed by the increased number of Vimentin+/RFP+ RGCs (D) and concomitant decrease of Ascl1+/RFP+(E) and Dcx+/RFP+(F) non-RGCs, respectively, when compared to an empty RFP control plasmid 2 dpe (Vimentin: 100 ± 3.2 vs. 150.5 ± 1.6; Ascl1: 100 ± 8.4 vs. 48.2 ± 3.1; Dcx: 100 ± 3.3 vs. 39.5 ± 6.3). This blockade of differentiation was further supported by an increase in Dcx+/RFP+ type-A cells retaining expression of the type-C cell marker Ascl1 (Dcx+Ascl1+, 100 ± 25.7 vs. 308.5 ± 50.3) ( G ). P values: *P <0.05; **P <0.01; ***P <0.001. Quantifications were normalized to control conditions (D–G). Scale bars: A, 10 μm.

We next confirmed the blockade of RGC differentiation after ectopic dnE47 using these antigenic criteria. Overexpression of dnE47 resulted in an increase in the number of Vimentin+/RFP+ cells (Figure 2D, Additional file 1E), whilst the numbers of Ascl1+/RFP+ (type-C) and Dcx+/RFP+ (type-A) precursors were concomitantly decreased at 2 dpe compared to controls (Figure 2E,F, Additional file 1F,G). Strikingly, the retention of a more immature phenotype by the electroporated cells was further supported by the 3-fold increase of Dcx+ cells, still expressing type-C cell specific Ascl1 (Figure 2G).

Altogether, these experiments demonstrate that the progression of RGC differentiation can be analyzed based on morphological criteria and reveal a dependence of NSC differentiation on Class I/II bHLH transcriptional activity in the postnatal SVZ.

E-proteins exhibit a complex spatio-temporal pattern of expression in the postnatal forebrain

Based on these findings, we further explored both spatial and temporal E-protein expression in the postnatal and adult forebrain. We first analyzed the spatial pattern of expression by in situ hybridization (ISH) at postnatal day 6 (P6) and 60 (P60). All three genes coding for E-proteins (E2-2, E2A, and HEB) were abundant in the postnatal forebrain and were enriched in germinal zones, i.e., dentate gyrus, SVZ, and RMS at P6 (Figure 3A,B). These results were confirmed by real-time quantitative polymerase chain reaction (RT-qPCR) measurement from the microdissected lateral SVZ and adjacent parenchyma (i.e., striatum). All E-protein transcripts were enriched in the SVZ, with a clear predominance of E2-2 and E2A (Figure 3C). At P60, E-protein transcripts were generally less abundant compared to earlier postnatal ages. While E2-2 expression was still enhanced in the SVZ and the RMS, E2A and HEB expression levels were only marginally higher than in non-germinal regions (Figure 3A,B), thus implying that E2-2 may be required for neuronal differentiation continually during development and into adulthood.

Figure 3
figure 3

E-protein mRNA expression is enriched in germinal regions of the postnatal and adult forebrain and is increased during NSC differentiation in vitro and in vivo . (A) ISH of E2-2, E2A, and HEB revealed its enhanced expression in the SVZ (dashed zone at P60), the RMS, and the dentate gyrus, when compared to non-neurogenic regions (i.e., thalamus, cortex) at P6 as well as P60. (B) Inverted greyscale quantification of A . (C) E2-2, E2A, and HEB transcripts were highly expressed in the lateral SVZ compared to the striatum (dashed zone circling both regions) (0.18 ± 0.03 vs. 0.5 ± 0.06, 0.02 ± 0.004 vs. 0.46 ± 0.08, 0.003 ± 0.0004 vs. 0.07 ± 0.01, respectively). (D) Upon differentiation, E-protein mRNA levels were upregulated in NS5 cells (two-way ANOVA followed by Dunnett’s post hoc test). Differentiation progress was confirmed by upregulation of doublecortin (Dcx) transcripts, an early neuronal marker, and normalized to GAPDH and shown as a percentage vs. D0. (E) E-protein transcription, in particular E2-2, was enhanced in more mature PSA-NCAM+ MAC sorted neuroblasts compared to earlier Prominin-1+ (or CD133+) NSCs/progenitors (100 ± 32.0 vs. 687.8 ± 226.4, 100 ± 9.9 vs. 145.4 ± 15.4, 100 ± 12.1 vs. 144.0 ± 17.4, respectively). Cell sorting efficiency was confirmed by enrichment of Dcx (100 ± 34.0 vs. 1291.3 ± 438.6) and CD24 (100 ± 17.8 vs. 270.1 ± 48.1) transcripts in neuroblasts, while the generic NSC transcripts GFAP (100 ± 20.4 vs. 22.1 ± 4.5) and Id1 (100 ± 6.5 vs. 72.8 ± 4.7) were enriched within Prominin-1+ sorted cells. P values: *P <0.05; **P <0.01; ***P <0.001. All quantifications were normalized to control conditions (D, E).

Having demonstrated an enrichment of E-protein transcripts in germinal regions of the postnatal forebrain, regulation during early neuronal differentiation was assessed. In vitro differentiation of the NS5 cell line increased the expression of all E-protein transcripts. Upregulation of E2-2 and HEB had occurred following 24 h, before any increase of doublecortin (Dcx), a neuronal differentiation marker, could be detected. After 48 h of differentiation, all E-protein transcripts were significantly upregulated (Figure 3D).

A similar upregulation was observed in vivo. Early progenitors and committed neuroblasts were isolated based on their differential expression of the cell surface markers Prominin-1 and PSA-NCAM, respectively. Measurements of cell-specific markers confirmed the efficiency of the approach by showing that Prominin-1+ sorted cells were enriched for the stem cell markers GFAP and Id1, while Dcx and CD24 enrichment was prominent in PSA-NCAM+ sorted cells. Measurements of E-protein transcripts by RT-qPCR revealed that E2-2 and, to a lesser extent, E2A and HEB, were strongly upregulated in the postnatal SVZ during NSCs differentiation (Figure 3E).

Altogether, our results indicate that E-protein expression is spatially and temporally regulated in a pattern that matches NSC differentiation during postnatal forebrain development.

E-protein manipulation alters the progression of NSC differentiation in the postnatal SVZ

We next performed further E-protein gain-of-function (GoF) and loss-of-function (LoF) experiments in the postnatal lateral SVZ, by means of plasmid electroporation (as above) (Figure 4A). We focused this functional characterization onto E2-2, which appears to be the most prominent E-protein expressed in the postnatal and adult SVZ (see above), and E2A, which is the best studied E-protein in CNS development [23, 25, 29, 35–37].

Figure 4
figure 4

E2-2 and E2A sequentially affect RGC differentiation and progenitor proliferation. (A) Representative illustration of a green fluorescence protein (GFP) plasmid electroporation into the lateral wall of the LV. (B) In vitro characterization of the shRNAs used in this study. shRNA against E2-2 or E2A decreased E2-2 or E2A expression (100 ± 18.9 vs. 17.2 ± 2.4 or 100 ± 20.2 vs. 20.9 ± 2.5, respectively) within neurosphere cultures, when co-nucleofected with E2-2 or E47 overexpression plasmids, respectively. (C) E2-2 and E47 overexpression constructs increased transition from RGCs (bipolar processes, apical connection to LV lumen) to non-RGCs (no processes, spherical morphologies, distant from the LV wall) at 2 dpe (100 ± 3.9 vs. 130.5 ± 3.0 or 139.7 ± 1.4, respectively). When shRNA plasmids against E2-2 or E2A were applied, most electroporated cells maintained a RGC morphology, as reflected by the reduced ratio of non-RGC cells compared to control conditions (100 ± 3 vs. 81 ± 6.4 or 82.9 ± 3.6, respectively). Confocal micrographs illustrate RGCs and non-RGCs coexisting in the neurogenic niche. Inserts show a schematic view of the RGC to non-RGC transition. (D) E2-2 and E47 overexpression constructs decreased Ki67 immunoreactivity within progenitors (non-RGC) at 2 dpe (100 ± 5.6 vs. 61 ± 3.5 or 64.7 ± 4.1, respectively). shRNA constructs against E2-2 and E2A-induced opposite effects (100 ± 8 vs. 216 ± 13.2 or 161.9 ± 12.7, respectively). Confocal micrographs illustrate representative non-RGCs positive or negative for Ki67, respectively. P values: *P <0.05; **P <0.01; ***P <0.001. All quantifications were normalized to control conditions. Scale bars: C, 20 μm; D, 10 μm.

GoF experiments resulted in the rapid transformation of RGCs into non-RGCs. Thus, whilst E2-2 and E2A overexpression increased the transformation of RGCs into non-RGCs by 30% and 40%, respectively, both E2-2 and E2A silencing decreased it by 20% (Figure 4B,C, Additional file 1H). We next focused our analysis on non-RGCs, which, at this early timepoint (2 dpe), consisted of transient amplifying progenitors (type-C) and neuroblasts (type-A) (Figure 2A,B). E-protein overexpression significantly reduced the proliferation of non-RGCs, as demonstrated by a ~45% decrease in the number of green fluorescence protein positive (GFP+) non-RGCs expressing the cell cycle marker Ki67. In contrast, LoF enhanced the proliferation capacity of non-RGCs (Figure 4D). Interestingly, these effects were more pronounced following E2-2 silencing, consistent with its higher expression in the postnatal SVZ compared to E2A (see above).

Altogether, these data are in agreement with the results obtained with the dnE47 construct (Figure 1D–F) and suggest that E-proteins control the differentiation of NSCs, and influence the cycling behavior of their progeny.

We next tested whether the changes in proliferation observed following E-protein GoF could be explained by cell cycle exit induction. Dividing cells in S-phase that incorporated 5-ethynyl-2′-deoxyuridine (EdU) 24 h prior to sacrifice, but did not re-enter another round of cell division (i.e., cell cycle exit), would no longer express Ki67. We quantified the number of EdU+Ki67–/EdU+ cells and found a doubling in the number of progenitors that had exited the cell cycle, when E2-2 was overexpressed (Figure 5A), whereas a smaller number of progenitors exited the cell cycle upon E2-2 silencing (Figure 5B). Finally, we tested whether E2-2-induced cell cycle exit resulted in an abortive differentiation or whether cells appropriately completed their differentiation into Dcx+ neuroblasts. We observed a ~30% increase of Dcx+ neuroblasts (type-A) within the postnatal forebrain at 2 dpe (Figure 5C, Additional file 1I), which paralleled the reduction of the number of RGCs described above, whereas the number of Ascl1+ type-C cells remained unaltered (Figure 5D, Additional file 1J).

Figure 5
figure 5

E2-2 alteration influences cell cycle exit of progenitors in vivo . (A) E2-2 overexpression increased cell cycle exit (EdU+Ki67–/EdU+) among the progenitor cell population (non-RGC) compared to control conditions at 2 dpe (100 ± 7.5 vs. 184.9 ± 18.0). Confocal micrographs show representative non-RGCs (GFP+) having cycled within 24 h prior to sacrifice (EdU+) and having re-engaged (Ki67+) or exited the cell cycle (Ki67–), respectively. (B) In contrast, knock-down of E2-2 decreased cell cycle exit within the progenitor pool as illustrated by the increased Ki67 immunoreactivity among EdU+ non-RGCs, when compared to control conditions (Scrambled) (100 ± 7.8 vs. 65.8 ± 1.3). (C, D) E2-2 overexpression also increased the number of Dcx+ neuroblasts (100 ± 0.5 vs. 128.1 ± 2.9) (C), whereas the number of Ascl1+ type-C cells remained unchanged (100 ± 6.4 vs. 94.6 ± 9.2) (D). (E) Percentage of cell type composition (i.e., type-B = RGC, type-C = Ascl1+, type-A = Dcx+) upon E2-2 overexpression, when compared to an empty control plasmid at 2 dpe (30.7 ± 4.6 vs. 14.2 ± 2.3, 30.0 ± 1.2 vs. 35.6 ± 2.5, 39.2 ± 0.3 vs. 50.2 ± 1.8, respectively). (F) Summary model: E2-2 orchestrates neurogenesis progression within the murine forebrain. P values: *P <0.05; **P <0.01; ***P <0.001. Quantifications were normalized to control conditions (A–D). Scale bars: A &B, 20 μm.

Taken together, these results highlight an important role of E-proteins in controlling the timing and progression of NSC differentiation in the postnatal SVZ. Thus, upon E2-2 overexpression, a concomitant decrease of type-B RGCs and increase of Dcx+ type-A cells was observed. These observations, together with the stable number of Ascl1+ type-C cells, suggest a more rapid differentiation of E2-2 overexpressing cells as schematized in Figure 5E,F.

E47 disruption is not sufficient to mediate the switch of Ascl1-dependent transcription

E-proteins induce NSC differentiation by transactivation of bHLH proneural proteins. Among those is Ascl1, expressed mainly by progenitor cells in the postnatal forebrain [19, 38]. We confirmed the interdependence of E-proteins and Ascl1 by NSC differentiation induction, combining GoF and LoF experiments in isolated progenitors in vitro. Ascl1 knock-down resulted in a complete loss of Map2 mRNA transcription, when E2-2 or E47 were concomitantly overexpressed. This confirms that E-protein activity is largely dependent on Ascl1 expression. On the other hand, Ascl1 is still able to exert its function although to a lesser extent upon silencing of E2-2, but not after silencing E2A, illustrating both redundancy but also a strong dependency on E2A expression in SVZ-derived progenitor cells (Figure 6A).

Figure 6
figure 6

E47 fails to trigger Ascl1 to switch from proliferation to differentiation target genes. (A) Map2 mRNA expression was elevated when Ascl1 was overexpressed in isolated neurospheres in vitro (100 ± 19.1 vs. 299.4 ± 5.8). Concomitant knock-down of E2-2 or E2A using shRNA, respectively, reduced or abolished Ascl1-dependent Map2 expression (299.4 ± 5.8 vs. 222.2 ± 3.7 or 94.9 ± 9.8, respectively). More strikingly, Ascl1 silencing decreased Map2 expression level to control conditions, when E2-2 (100 ± 19.1 vs. 242.4 ± 34.2, 242.4 ± 34.2 vs. 100.3 ± 4.9) or E47 (100 ± 19.1 vs. 214.6 ± 7.1, 214.6 ± 7.1 vs. 125.7 ± 13.6) was overexpressed. (B) Although significant expression changes could be detected, E-protein gain-of-function did not systematically promote activation of Ascl1 target genes mediating cell cycle arrest. Inversely, E-protein silencing did not activate Ascl1 target genes mediating cell cycle progression. P values: *P <0.05; **P <0.01; ***P <0.001. All quantifications were normalized to control conditions.

The bHLH protein Ascl1 has recently been shown to control proliferation and differentiation in neural progenitors by sequentially activating cell cycle progression and cell cycle arrest genes in a context-dependent manner [22]. Therefore, we next assessed whether modifications in E-protein expression levels that occur during neural progenitor cell differentiation could mediate this molecular switch. E2A, in the form of E47, known to be the main E-protein binding to Ascl1 [21], was overexpressed or silenced in isolated neurosphere cultures and the level of expression of Ascl1 targets, reported to be differentially expressed during cell cycle progression (FoxM1, Cdk4) and cell cycle arrest (Gadd45g, Ccng2, Btg2, Prmt2) [22], was measured by RT-qPCR. No consistent change in expression of genes differentially targeted by Ascl1 was detected following E2A GoF or LoF (Figure 6B).

In summary, the divergent context-dependent function of Ascl1 in promoting cell proliferation and in triggering differentiation, as described recently [22], is apparently independent of E-protein activity. Rather, these findings propose that E-protein upregulation during NSC differentiation is likely to act in parallel with other signaling pathways to fine-tune differentiation progression in an Ascl1-dependent manner [39].

Discussion

In the present study, we demonstrate enriched expression of E-proteins in postnatal germinal regions of the murine forebrain and highlight their key role as transcriptional orchestrators of postnatal SVZ neurogenesis.

bHLH family members are known to regulate a variety of developmental programs in several tissues of the organism, such as myogenesis, hematopoiesis, and pancreatic and heart development, as well as neurogenesis [5]. In the CNS, proneural Class II proteins are the most studied members of the bHLH family. They were shown to be indispensable and sufficient to induce neurogenesis in drosophila [40], C. elegans[41, 42], and mice [43]. During telencephalic development, Neurog2 and Ascl1 confer an opposing dorso-ventral expression gradient to specify distinct neuronal populations [44].

However, less is known regarding Class I bHLH protein expression patterns and their role during neurogenesis. In drosophila, Daughterless (E-protein homolog) knock-out results in defective precursor differentiation [45, 46]. In contrast, deletion of single Class I bHLH protein members in rodents led to no gross anatomical phenotype [26] or spatially restricted developmental deficits [47]. Deletion of multiple E-proteins resulted in stronger phenotypes highlighting some degree of redundancy in between these genes [26]. Our co-expression experiments confirmed the potential interchangeability of E-proteins, since E2-2, E47, and HEB were equally potent in transactivating Ascl1, even though the LoF analysis revealed Ascl1 to preferentially bind E47. Sequence analysis studies revealed extremely high sequence conservation within, as well as beyond, the HLH domains supporting possible redundancy among individual E-proteins [23]. Indeed, functional replacement of the mouse E2A gene with an E2A promoter-driven human HEB cDNA rescued B-cell commitment and differentiation during B-lymphopoiesis [37].

Furthermore, expression studies have proposed a regulation of E-protein transcription during development, with a gradual restriction to germinal regions in the CNS [25], supporting key neurogenesis functions. Our ISH combined with RT-qPCR gene expression analysis confirmed an enrichment of all E-protein transcripts in postnatal and adult germinal regions of the forebrain when compared to non-neurogenic regions. Notably, these expression experiments uncovered E2-2 as the most abundant E-protein in the SVZ, followed by a less prominent expression for E2A and HEB. Additionally, E-proteins seem not only to be restricted spatially but also temporally during lineage progression. More differentiated progenitors exhibited increased transcription levels in vitro as well as in vivo, further implicating a specialized function in maintaining proper neurogenesis behavior. Altogether, these results highlight a complex regulation of E-protein expression in germinal regions of the postnatal forebrain.

The dramatic blockade of NSC differentiation and subsequent neurogenesis observed following dnE47 overexpression in vitro as well as in vivo underlines the importance of a functional bHLH network for lineage progression. Based on these findings, we further aimed at manipulating E-protein expression more concisely in the lateral SVZ using overexpression and shRNA plasmids within an established postnatal electroporation approach [31, 32]. Major alterations in progenitor proliferation and cell cycle exit were evident. These results are in agreement with a previously described role of E2A in cell cycle regulation in transiently transfected NIH3T3 fibroblasts, by activating cyclin-dependent kinase inhibitors [27, 48, 49]. Moreover, Id proteins, known E-protein antagonists (see above), enhance cell cycle duration and prevent cell cycle exit, which was further confirmed with a decreased cyclinD1 and increased p27Kip1 (cyclin-dependent kinase inhibitor 1B) expression within the VZ of triple knock-out mice [18]. In line with Id protein mediated anchorage to the neurogenic niche [18], E-proteins were also reported to actively repress expression of E-cadherin, a cell adhesion molecule [50, 51]. Recent studies in drosophila, revealing a direct transcriptional regulation of Emc (Id protein homolog) by Daughterless, coupled with the physical sequestration of E-proteins by Class V bHLH members [6], results in an autoregulatory feedback [24, 52]. In addition, E-protein expression and therefore lineage progression seems to be initially mediated by extracellular signaling pathways, which is consistent with earlier reports, suggesting a general role for Shh and BMPs in SVZ neurogenesis [53–55]. In drosophila, it was demonstrated that Hh (Shh homolog) and Dpp (BMP homolog) specifically repress Id expression and thus increase E-protein activity [24], ultimately leading to germinal niche detachment and altered cell cycle behavior.

Our findings suggest that the effects of E-proteins on SVZ NSC differentiation are entirely dependent on Ascl1, which is expressed in all postnatal SVZ progenitors [19, 56]. Knock-down of Ascl1 entirely abrogated the proneural activity of E2-2 and E2A, demonstrating that E-proteins converge with the same Class II bHLH protein. The incomplete loss of Ascl1 activity when E2-2 is silenced is likely due to a persistent endogenous E47 activity, as Ascl1 seems to rely more on E2A than on E2-2, demonstrated by the absence of Ascl1 activity upon E2A silencing. Recent findings propose that sustained Ascl1 expression favors cell differentiation, whereas oscillatory expression correlates more with proliferative cell fates [57]. Given that E-proteins, in competition with Id proteins, tightly regulate Ascl1 protein stability [58] and that Ascl1 has lately been demonstrated to target two subsets of genes, namely proliferation- and differentiation-associated genes [22], we investigated a role for E-proteins in mediating this switch in binding bias. However, in the present study, E2A alterations did not induce directed and systematic gene expression changes, at least for the Ascl1 target genes tested, most likely mitigating the probability of E-proteins to induce differentiation through promoting Ascl1 binding and activation of cell cycle arrest genes. This implies that E-proteins are likely to operate in parallel with other signaling pathways to fine tune differentiation progression in an Ascl1-dependent manner [39].

Although our results did not reveal significant differences in the expression pattern of distinct E-proteins during postnatal SVZ neurogenesis, and suggest an interchangeability of E-proteins in the context of Ascl1-induced SVZ NSC differentiation, it should be noted that the dimerization properties of bHLH proteins can be affected at the post-translational level. For example, GSK3β phosphorylation of Neurog2 was described to influence its dimerization with E47 in the developing cortex, thereby affecting its transcriptional activity [59]. Similar mechanisms might be at play in the postnatal SVZ to fine tune the choice of proneural/E-protein-binding partners and regulate individual aspects of NSC differentiation, such as, for example, specification. Previous studies have indeed demonstrated a specific role of E2-2 for the generation of a unique subset of neural progenitors during pontine development [47], despite the presence of other E-proteins. Also, B- and T-lymphocyte specification was shown to be orchestrated by E2A and HEB [60, 61]. Whether Class I/II bHLH protein dimerization is dynamically regulated in the postnatal SVZ to influence fate specification is currently unknown and will be the subject of future investigations. Performing such experiments in the postnatal SVZ is particularly attracting due to the regional expression of some proneural proteins as, for example, Neurog2, which shows dorsal enrichment in the postnatal SVZ in a population that gives rise to glutamatergic neurons [62, 63].

Conclusions

In the present work, we demonstrate a diverse expression pattern of Class I bHLH proteins and underpin their underestimated significance in orchestrating early neuronal lineage progression. However, the precise mechanism behind E-proteins regulating NSC differentiation remains to be elucidated, but is unlikely to rely solely on Ascl1 heterodimerization.

Methods

Cell culture and in vitro nucleofection

The mouse embryo-derived and immortalized RGC line NS5 was cultured as described earlier [28] and was nucleofected following the manufacturer’s instructions using a 4D-nucleofector device with SG solution (Lonza, Basel, Switzerland) and the EN150 program with a maximum of 0.5 μg of plasmid DNA per 1 × 106 cells. NS5 cell differentiation was achieved by plating cells into polyornithin-coated (0.001% in H2O, Sigma-Aldrich, St. Louis, MO, USA) and laminin-coated (20 μg/mL in H2O, Life Technologies, Carlsbad, CA, USA) flasks in D1 medium (Euromed-N stem cell medium; Lucerna Chem, Lucerne, Switzerland) supplemented with 1% penicillin/streptomycin, 0.25% L-glutamine, 1% B27 (Life Technologies), 0.5% N2 (Life Technologies), and 5 ng/mL FGF2 (Peprotech, Hamburg, Germany) [64].

Neurosphere-forming progenitor cells were isolated from the SVZ of P4 aged animals. The SVZ was microdissected and the tissue digested with a solution of DNAse I (Worthington, Lakewood, NJ, USA), Papain (Worthington), and Dispase II (Roche, Basel, Switzerland), subsequently triturated and filtered through a 70 μm cell strainer (BD Biosciences, Franklin Lakes, NJ, USA). Cells were plated into DMEM/F12 medium supplemented with 1% N2, EGF, FGF2 (both 20 ng/mL, Peprotech), heparin (1 μg/mL), and 1% penicillin/streptomycin. For nucleofections, a mouse neural stem cell solution (Lonza), program DS113, and a maximum of 1 μg of plasmid DNA per 1 × 106 cells were used.

Both NS5 and progenitor cells were subjected to RNA isolation and subsequent RT-qPCR 24 to 48 h post-nucleofection.

Animals and postnatal electroporation

All animal experiments were performed in agreement with the Canton of Zurich veterinary office guidelines (authorization 182/2011). All mice used in this study were of the CD1 (Swiss mice) strain and were obtained from the Charles River laboratory.

Electroporation of RGCs lining the lateral ventricle was performed on postnatal-day-2 mice (P2), as described previously [31, 32]. In brief, following anesthesia by hypothermia, P2 pups were injected with 2 μL of plasmid solution (5 μg/μL in PBS). Fast Green 1% (Sigma-Aldrich) was used to assess accuracy of the intra-ventricular injections. Successfully injected mice were subjected to five electrical pulses (95 V, 50 ms, separated by 950 ms intervals) using the ECM 830 BTX electroporator (Harvard Apparatus, Holliston, MA, USA) and tweezer electrodes (5 mm diameter; BTX Tweezertrodes, Harvard Apparatus) coated with conductive gel (Signa gel, Parker Laboratories, Fairfield, NJ, USA). For proliferation studies, 50 mg/kg 5-ethynyl-2′-deoxyuridine (EdU) were administered subcutaneously 24 h prior to sacrifice.

Tissue processing

Two days post-electroporation, mice were deeply anesthetized (150 mg/kg pentobarbital, i.p.) and transcardially perfused with Ringer solution supplemented with heparin (250 mg/L, Sigma-Aldrich) followed by 4% paraformaldehyde (PFA) (Sigma-Aldrich). Then, 50 μm thick vibratome sections (Leica, Wetzlar, Germany) were collected as a series of six encompassing the entire rostro-caudal extent of the lateral ventricle. Sections were stored at –20°C in antifreeze solution (25% Glycerol, 25% Ethylenglycol and 50% 0.1 M PB).

Immunostaining

All immunostainings were performed on a complete series of free-floating sections. Blocking and permeabilization were achieved by incubating the sections for 2 h in 0.1 M PB supplemented with 0.4% Triton-X100 and a TNB buffer (thereafter mentioned as 0.4% TNB-TX100) consisting of 0.05% Casein (Sigma-Aldrich), 0.25% bovine serum albumin (Sigma-Aldrich), and 0.25% Topblock (Lubio Science, Lucerne, Switzerland) at room temperature. Afterwards, primary antibody incubations were performed in 0.4% TNB-TX100 at 4°C overnight (M α Ki67, 1:300 (BD Biosciences); Rb α Ki67, 1:500 (MM France, Francheville, France); G α Dcx, 1:300 (Santa Cruz Biotechnology, Santa Cruz, CA, USA); Ch α Vimentin, 1:1000 (Millipore, Darmstadt, Germany); and M α Ascl1, 1:300 (BD Biosciences)). Then, incubation with species-matched secondary antibodies (Life Technologies) was performed for 2 h at 4°C in 0.4% TNB-TX100. GFP signal was amplified using a biotin-conjugated secondary antibody against the GFP primary antibody (Ch α GFP, 1:1,000 (Aves Labs, Tigard, OR, USA)). In addition, the tissues were incubated for 15 min with a biotin-specific streptavidin Alexa 488 complex. Finally, sections were counterstained using 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) and coverslipped with antifading mounting medium (Vectashield, Vector Labs, Burlingame, CA, USA).

For nuclear stainings, an antigen retrieval protocol was applied. Sections were incubated with 10 mM tri-sodium citrate buffer (+0.05% Tween 20, pH 6.0) for 30 min at 80°C and 20 min at room temperature.

Detection of EdU incorporation was performed using the Click-it EdU system (Life Technologies) according to the manufacturer’s instructions.

In situ hybridization

In situ RNA hybridization was performed as previously described [65]. After dissection, postnatal or adult brains were fixed in 4% PFA at 4°C for 48 or 24 h, respectively, cryoprotected in 30% sucrose at 4°C overnight, cryosectioned at 20 μm on consecutive slides, and stored at −80°C. Sections were acetylated with 0.1 M triethanolamine and 2.5 μL/mL acetanhydride for 10 min and additionally fixed in 4% PFA at RT for 15 min before prehybridization for 4 h followed by 1 to 2 μg/mL probe hybridization for 16 h at 65°C. The antisense E2-2 [NM_013685], E2A [NM_011548], and HEB [NM_011544] probes were derived from plasmid constructs, whereas linearized templates were transcribed using a T7 RNA polymerase (Thermo Fisher Scientific, Waltham, MA). Anti-DIG FAB (1:2000 (Roche)) immunostaining was applied at 4°C overnight and subsequently developed in buffer containing BCIP (175 μg/mL) and NBT (100 μg/mL) for 12-48 h.

Microdissection and MAC sorting

To determine the spatio-temporal E-protein expression pattern, the SVZ or the striatum were microdissected from mice aged P6 as described in previously published protocols [66]. In brief, NSCs and neuroblasts were isolated by magnetic affinity cell sorting (MACS) using conjugated antibodies against the transmembrane proteins Prominin-1, also known as CD133, and PSA-NCAM. Dissected tissues were pooled in Hanks buffered salt solution (Life Technologies) and dissociated using a trypsin-based kit following manufacturer’s guidelines (Miltenyi Biotec, Bergisch Gladbach, Germany). Then, anti-Prominin-1 or anti-PSA-NCAM antibodies conjugated with magnetic beads (Miltenyi Biotec) were applied to the cell suspension for 30 min at 4°C before they were passed through MACS separator columns (Miltenyi Biotec). Sorted cells were snap-frozen for subsequent RT-qPCR. One litter represents 1 ‘n’ number.

Gene expression analysis

RNA was extracted, processed, and amplified from tissues/cells as previously described [32]. For RT-qPCR, 20 ng of cDNA were loaded with 5 μm of forward and reverse primers (Map2: fw_GCTGAAGCTGTAGCAGTCCTGAA, rv_GTGTTGGGCTTCCTTCTCTTGT; E2-2: fw_GGGAAAGCCCTAGCTTCGAT, rv_CCCACAGGACTTGAAGGATTG; E2A: fw_TGGGCTCTGACAAGGAACTGA, rv_CCGGCTCTTCCCATTGG; HEB: fw_CCATCCCCAAATTCTGACGAT, rv_GCTGGCTCATCCCATTCG; Dcx: fw_CTGACTCAGGTAACGACCAAGAC, rv_TTCGAGGGCTTGTGGGTGTAGA; CD24: fw_ACATCTGTTGCACCGTTTCCCG, rv_CAGGAGACCAGCTGTGGACTG; GFAP: fw_GCAGAAGCTCCAAGATGAAAC, rv_CCTTTCTCTCCAAATCCACAC; Id1: fw_CCTAGCTGTTCGCTGAAGGC, rv_CTCCGACAGACCAAGTACCAC; ABCG2: fw_CTCAACCTGCCCATTTCAAATGCT, rv_GTTGGAAGTCGAAGAGCTGCTGAGA; Gadd45g: fw_CTGCTGTGAGAACGACATTG, rv_GGTCCTTCCATGTGTCCTCA; Ccng2: fw_CTACAGTGTTCCTGAGCTGC, rv_GTCTGAGCCACTTGGAAGTC; Btg2: fw_GCGAGCAGAGACTCAAGGTT, rv_CGGATACAGCGATAGCCAGA; Prmt2: fw_CCACAGCAAGGTGCTCTTCT, rv_TGCATGGCTCAGAGAGACAG; FoxM1: fw_CTACACTTGGATTGAGGACC, rv_CCATTGGCAGATGTCTCTCG; Cdk4: fw_GGACCTGAAGCCAGAGAACA, rv_AGATACAGCCAACGCTCCAC), SYBR green mastermix (Roche), and DNAse/RNAse free H20 (Sigma-Aldrich) onto 96-well plates for LightCycler 480 (Roche). All samples were run in duplicates or triplicates, whereas glyceraldehyde-3-phosphate dehydrogenase (GAPDH: fw_CGACTTCAACAGCAACTCCCACTCTTCC, rv_TGGGTGGTCCAGGGTTTCTTACTCCTT) was used as reference gene. Relative gene expression was determined using the ΔΔ-CT method [67].

Analysis

Images were acquired with a laser scanning confocal microscope (Olympus IX 81, Olympus, Tokyo, Japan) equipped with a 20× or 40× objective, or with an epifluorescence microscope (Leica DM5500 B, Leica). Quantifications following in vivo electroporations are based on an average cell count of 254 successfully transfected cells per animal (n ≥5). Each animal represented 1 ‘n’ number. Morphological criteria to define RGCs were bipolar morphology and apical connection to the LV lumen. Morphological criteria to define non-RGCs were absence of apical and basal processes (i.e., roundish appearance), and absence of contact to the LV lumen [31, 32].

All data are expressed as mean and standard error of the mean (±SEM). P values were determined using unpaired t-test or two-way ANOVA followed by Dunnett’s post hoc test (GraphPad Prism v5 software, San Diego, CA, USA).

Abbreviations

bHLH:

Basic-helix-loop-helix

CNS:

Central nervous system

dnE47 :

Dominant-negative E47

dpe:

Days post-electroporation

EdU:

5-ethynyl-2′-deoxyuridine

GFP:

Green fluorescence protein

GoF:

Gain-of-function

ISH:

In situ hybridization

LoF:

Loss-of-function

LV:

Lateral ventricle

MACS:

Magnetic affinity cell sorting

non-RGC:

Non-radial glial cell

NSC:

Neural stem cells

PFA:

Paraformaldehyde

RGC:

Radial glial cell

RMS:

Rostral migratory stream

RT-qPCR:

Real-time quantitative polymerase chain reaction

SVZ:

Subventricular zone.

References

  1. Ponti G, Obernier K, Guinto C, Jose L, Bonfanti L, Alvarez-Buylla A: Cell cycle and lineage progression of neural progenitors in the ventricular-subventricular zones of adult mice. Proc Natl Acad Sci U S A. 2013, 110: E1045-E1054. 10.1073/pnas.1219563110.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  2. Doetsch F, Caille I, Lim DA, García-Verdugo JM, Alvarez-Buylla A: Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell. 1999, 97: 703-716. 10.1016/S0092-8674(00)80783-7.

    Article  CAS  PubMed  Google Scholar 

  3. Lois C, Alvarez-Buylla A: Long-distance neuronal migration in the adult mammalian brain. Science. 1994, 264: 1145-1148. 10.1126/science.8178174.

    Article  CAS  PubMed  Google Scholar 

  4. Lledo P-M, Merkle FT, Alvarez-Buylla A: Origin and function of olfactory bulb interneuron diversity. Trends Neurosci. 2008, 31: 392-400. 10.1016/j.tins.2008.05.006.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  5. Massari ME, Murre C: Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol Cell Biol. 2000, 20: 429-440. 10.1128/MCB.20.2.429-440.2000.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  6. Ross SE, Greenberg ME, Stiles CD: Basic helix-loop-helix factors in cortical development. Neuron. 2003, 39: 13-25. 10.1016/S0896-6273(03)00365-9.

    Article  CAS  PubMed  Google Scholar 

  7. Knust E, Bremer KA, Vässin H, Ziemer A, Tepass U, Campos-Ortega JA: The enhancer of split locus and neurogenesis in drosophila melanogaster. Dev Biol. 1987, 122: 262-273. 10.1016/0012-1606(87)90351-4.

    Article  CAS  PubMed  Google Scholar 

  8. Sasai Y, Kageyama R, Tagawa Y, Shigemoto R, Nakanishi S: Two mammalian helix-loop-helix factors structurally related to drosophila hairy and Enhancer of split. Genes Dev. 1992, 6: 2620-2634. 10.1101/gad.6.12b.2620.

    Article  CAS  PubMed  Google Scholar 

  9. Murre C, Bain G, Dijk MAV, Engel I, Furnari BA, Massari ME, Matthews JR, Ouong MW, Rivera RR, Stuiver MH: Structure and function of helix-loop-helix proteins. Biochim Biophys Acta. 1994, 1218: 129-135. 10.1016/0167-4781(94)90001-9.

    Article  CAS  PubMed  Google Scholar 

  10. Ishibashi M, Ang S-L, Shiota K, Nakanishi S, Kageyama R, Guillemot F: Targeted disruption of mammalian hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev. 1995, 1: 3135-3148.

    Google Scholar 

  11. Ohtsuka T, Ishibashi M, Gradwohl G, Nakanishi S, Kageyama R: Hes1 and Hes5 as Notch effectors in mammalian neuronal differentiation. EMBO J. 1999, 18: 2196-2207. 10.1093/emboj/18.8.2196.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  12. Rothschild G, Zhao X, Iavarone A, Lasorella A: E proteins and Id2 converge on p57 Kip2 to regulate cell cycle in neural cells. Mol Cell Biol. 2006, 26: 4351-4361. 10.1128/MCB.01743-05.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  13. Chen H, Thiagalingam A, Chopra H, Borges MW, Feder JN, Nelkin BD, Baylin SB, Ball DW: Conservation of the drosophila lateral inhibition pathway in human lung cancer: a hairy-related protein (HES-1) directly represses achaete-scute homolog-1 expression. Proc Natl Acad Sci U S A. 1997, 94: 5355-5360. 10.1073/pnas.94.10.5355.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  14. Davis RL, Turner DL: Vertebrate hairy and enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene. 2001, 20 (58): 8342-8357. 10.1038/sj.onc.1205094.

    Article  CAS  PubMed  Google Scholar 

  15. Alifragis P, Poortinga G, Parkhurst SM, Delidakis C: A network of interacting transcriptional regulators involved in drosophila neural fate specification revealed by the yeast two-hybrid system. Proc Natl Acad Sci U S A. 1997, 94: 13099-13104. 10.1073/pnas.94.24.13099.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  16. Norton JD: ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. J Cell Sci. 2000, 113: 3897-3905.

    CAS  PubMed  Google Scholar 

  17. H-s N, Benezra R: High levels of Id1 expression define B1 type adult neural stem cells. Cell Stem Cell. 2009, 5: 515-526. 10.1016/j.stem.2009.08.017.

    Article  Google Scholar 

  18. Niola F, Zhao X, Singh D, Castano A, Sullivan R, Lauria M, Nam H-S, Zhuang Y, Benezra R, Bernardo DD, Iavarone A: Id proteins synchronize stemness and anchorage to the niche of neural stem cells. Nat Cell Biol. 2012, 14: 477-487. 10.1038/ncb2490.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  19. Parras CM, Galli R, Britz O, Soares S, Galichet C, Battiste J, Johnson JE, Nakafuku M, Vescovi A, Guillemot F: Mash1 specifies neurons and oligodendrocytes in the postnatal brain. EMBO J. 2004, 23: 4495-4505. 10.1038/sj.emboj.7600447.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  20. Farah MH, Olson JM, Sucic HB, Hume RI, Tapscott SJ, Turner DL: Generation of neurons by transient expression of neural bHLH proteins in mammalian cells. Development. 2000, 127: 693-702.

    CAS  PubMed  Google Scholar 

  21. Geoffroy CG, Critchley JA, Castro DS, Ramelli S, Barraclough C, Descombes P, Guillemot F, Raineteau O: Engineering of dominant active basic helix-loop-helix proteins that are resistant to negative regulation by postnatal central nervous system antineurogenic cues. Stem Cells. 2009, 27: 847-856. 10.1002/stem.17.

    Article  CAS  PubMed  Google Scholar 

  22. Castro DS, Martynoga B, Parras C, Ramesh V, Pacary E, Johnston C, Drechsel D, Lebel-Potter M, Galinanes Garcia L, Hunt C, Dolle D, Bithell A, Ettwiller L, Buckley N, Guillemot F: A novel function of the proneural factor Ascl1 in progenitor proliferation identified by genome-wide characterization of its targets. Genes Dev. 2011, 25: 930-945. 10.1101/gad.627811.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  23. Heng JIT, Tan S-S: The role of class I HLH genes in neural development — have they been overlooked?. Bioessays. 2003, 25: 709-716. 10.1002/bies.10299.

    Article  CAS  Google Scholar 

  24. Bhattacharya A, Baker NE: A network of broadly expressed HLH genes regulates tissue-specific cell fates. Cell. 2011, 147: 881-892. 10.1016/j.cell.2011.08.055.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  25. Roberts VJ, Steenbergen R, Murre C: Localization of E2A mRNA expression in developing and adult rat tissues. Proc Natl Acad Sci U S A. 1993, 90: 7583-7587. 10.1073/pnas.90.16.7583.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  26. Ravanpay AC, Olson JM: E protein dosage influences brain development more than family member identity. J Neurosci Res. 2008, 86: 1472-1481. 10.1002/jnr.21615.

    Article  CAS  PubMed  Google Scholar 

  27. Peverali FA, Ramqvist T, Saffrich R, Pepperkok R, Barone MV, Philipson L: Regulation of G1 progression by E2A and Id helix-loop-helix proteins. EMBO J. 1994, 13: 4291-4301.

    PubMed Central  CAS  PubMed  Google Scholar 

  28. Conti L, Pollard SM, Gorba T, Reitano E, Toselli M, Biella G, Sun Y, Sanzone S, Ying Q-L, Cattaneo E, Smith A: Niche-independent symmetrical self-renewal of a mammalian tissue stem cell. PLoS Biol. 2005, 3: 1594-1606.

    Article  CAS  Google Scholar 

  29. Mehmood R, Yasuhara N, Oe S, Nagai M, Yoneda Y: Synergistic nuclear import of NeuroD1 and its partner transcription factor, E47, via heterodimerization. Exp Cell Res. 2009, 315: 1639-1652. 10.1016/j.yexcr.2009.02.025.

    Article  CAS  PubMed  Google Scholar 

  30. Beyeler S, Joly S, Fries M, Obermair FJ, Burn F, Mehmood R, Tabatabai G, Raineteau O: Targeting the bHLH transcriptional networks by mutated E proteins in experimental glioma. Stem Cells. 2014, 32 (10): 2583-2595. 10.1002/stem.1776.

    Article  CAS  PubMed  Google Scholar 

  31. Fernandez ME, Croce S, Boutin C, Cremer H, Raineteau O: Targeted electroporation of defined lateral ventricular walls: a novel and rapid method to study fate specification during postnatal forebrain neurogenesis. Neural Dev. 2011, 6: 1-12. 10.1186/1749-8104-6-1.

    Article  Google Scholar 

  32. Azim K, Fischer B, Hurtado-Chong A, Draganova K, Cantu C, Zemke M, Sommer L, Butt A, Raineteau O: Persistent Wnt/beta-Catenin signaling determines dorsalization of the postnatal subventricular zone and neural stem cell specification into oligodendrocytes and glutamatergic neurons. Stem Cells. 2014, 32 (5): 1301-1312. 10.1002/stem.1639.

    Article  CAS  PubMed  Google Scholar 

  33. Gong S, Zheng C, Doughty ML, Losos K, Didkovsky N, Schambra UB, Nowak NJ, Joyner A, Leblanc G, Hatten ME, Heintz N: A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature. 2003, 425: 917-925. 10.1038/nature02033.

    Article  CAS  PubMed  Google Scholar 

  34. Basak O, Taylor V: Identification of self-replicating multipotent progenitors in the embryonic nervous system by high Notch activity and Hes5 expression. Eur J Neurosci. 2007, 25: 1006-1022. 10.1111/j.1460-9568.2007.05370.x.

    Article  PubMed  Google Scholar 

  35. Bain G, Maandag EC, Izon DJ, Amsen D, Kruisbeek AM, Weintraub BC, Krop I, Schlissel MS, Feeney AJ, van Roon M, van der Valk M, te Riele HPJ, Anton B, Cornelis M: E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell. 1994, 79: 885-892. 10.1016/0092-8674(94)90077-9.

    Article  CAS  PubMed  Google Scholar 

  36. Zhuang Y, Soriano P, Weintraub H: The helix-loop-helix gene E2A is required for B cell formation. Cell. 1994, 79: 875-884. 10.1016/0092-8674(94)90076-0.

    Article  CAS  PubMed  Google Scholar 

  37. Zhuang Y, Barndt RJ, Pan L, Kelley R, Dai M: Functional replacement of the mouse E2A gene with a human HEB cDNA. Mol Cell Biol. 1998, 18: 3340-3349.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  38. Beckervordersandforth R, Tripathi P, Ninkovic J, Bayam E, Lepier A, Stempfhuber B, Kirchhoff F, Hirrlinger J, Haslinger A, Lie DC, Beckers J, Yoder B, Irmler M, Götz M: In vivo fate mapping and expression analysis reveals molecular hallmarks of prospectively isolated adult neural stem cells. Cell Stem Cell. 2010, 7: 744-758. 10.1016/j.stem.2010.11.017.

    Article  CAS  PubMed  Google Scholar 

  39. Li S, Mattar P, Dixit R, Lawn SO, Wilkinson G, Kinch C, Eisenstat D, Kurrasch DM, Chan JA, Schuurmans C: RAS/ERK signaling controls proneural genetic programs in cortical development and gliomagenesis. J Neurosci. 2014, 34: 2169-2190. 10.1523/JNEUROSCI.4077-13.2014.

    Article  PubMed  Google Scholar 

  40. Ghysen A, Dambly-Chaudiere C: From DNA to form: the achaete-scute complex. Genes Dev. 1988, 2: 495-501. 10.1101/gad.2.5.495.

    Article  CAS  PubMed  Google Scholar 

  41. Hallam S, Singer E, Waring D, Jin Y: The C. elegans NeuroD homolog cnd-1 functions in multiple aspects of motor neuron fate specification. Development. 2000, 127 (19): 4239-4252.

    CAS  PubMed  Google Scholar 

  42. Portman DS, Emmons SW: The basic helix-loop-helix transcription factors LIN-32 and HLH-2 function together in multiple steps of a C. elegans neuronal sublineage. Development. 2000, 127: 5415-5426.

    CAS  PubMed  Google Scholar 

  43. Bertrand N, Castro DS, Guillemot F: Proneural genes and the specification of neural cell types. Nat Rev. 2002, 3: 517-530. 10.1038/nrn874.

    Article  CAS  Google Scholar 

  44. Casarosa S, Fode C, Guillemot F: Mash1 regulates neurogenesis in the ventral telencephalon. Development. 1999, 126: 525-534.

    CAS  PubMed  Google Scholar 

  45. Vaessin H, Brand M, Jan LY, Jan YN: Daughterless is essential for neuronal precursor differentiation but not for initiation of neuronal precursor formation in Drosophila embryo. Development. 1994, 120: 935-945.

    CAS  PubMed  Google Scholar 

  46. Hassan B, Vaessin H: Daughterless is required for the expression of cell cycle genes in peripheral nervous system precursors of Drosophila embryos. Dev Genet. 1997, 21: 117-122. 10.1002/(SICI)1520-6408(1997)21:2<117::AID-DVG1>3.0.CO;2-A.

    Article  CAS  PubMed  Google Scholar 

  47. Flora A, Garcia JJ, Thaller C, Zoghbi HY: The E-protein Tcf4 interacts with Math1 to regulate differentiation of a specific subset of neuronal progenitors. Proc Natl Acad Sci U S A. 2007, 104: 15382-15387. 10.1073/pnas.0707456104.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  48. Prabhu S, Ignatova A, Park ST, Sun XH: Regulation of the expression of cyclin-dependent kinase inhibitor p21 by E2A and Id proteins. Mol Cell Biol. 1997, 17: 5888-5896.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  49. Pagliuca A, Gallo P, De Luca P, Lania L: Class A helix-loop-helix proteins are positive regulators of several cyclin-dependent kinase inhibitors’ promoter activity and negatively affect cell growth. Cancer Res. 2000, 60: 1376-1382.

    CAS  PubMed  Google Scholar 

  50. Perez-Moreno MA, Locascio A, Rodrigo I, Dhondt G, Portillo F, Nieto MA, Cano A: A new role for E12/E47 in the repression of E-cadherin expression and epithelial-mesenchymal transitions. J Biol Chem. 2001, 276: 27424-27431. 10.1074/jbc.M100827200.

    Article  CAS  PubMed  Google Scholar 

  51. Cubillo E, Diaz-Lopez A, Cuevas EP, Moreno-Bueno G, Peinado H, Montes A, Santos V, Portillo F, Cano A: E47 and Id1 interplay in epithelial-mesenchymal transition. PLoS One. 2013, 8: e59948-10.1371/journal.pone.0059948.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  52. Meredith A, Johnson JE: Negative autoregulation of Mash1 expression in CNS development. Dev Biol. 2000, 222: 336-346. 10.1006/dbio.2000.9697.

    Article  CAS  PubMed  Google Scholar 

  53. Palma V, Lim DA, Dahmane N, Sanchez P, Brionne TC, Herzberg CD, Gitton Y, Carleton A, Alvarez-Buylla A, Ruiz i Altaba A: Sonic hedgehog controls stem cell behavior in the postnatal and adult brain. Development. 2005, 132: 335-344. 10.1242/dev.01567.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  54. Lim DA, Tramontin AD, Trevejo JM, Herrera DG, Garcia-Verdugo JM, Alvarez-Buylla A: Noggin antagonizes BMP signaling to create a niche for adult neurogenesis. Neuron. 2000, 28: 713-726. 10.1016/S0896-6273(00)00148-3.

    Article  CAS  PubMed  Google Scholar 

  55. Bonaguidi MA, Peng CY, McGuire T, Falciglia G, Gobeske KT, Czeisler C, Kessler JA: Noggin expands neural stem cells in the adult hippocampus. J Neurosci. 2008, 28: 9194-9204. 10.1523/JNEUROSCI.3314-07.2008.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  56. Azim K, Fiorelli R, Zweifel S, Hurtado-Chong A, Yoshikawa K, Slomianka L, Raineteau O: 3-dimensional examination of the adult mouse subventricular zone reveals lineage-specific microdomains. PLoS One. 2012, 7: e49087-10.1371/journal.pone.0049087.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  57. Imayoshi I, Isomura A, Harima Y, Kawaguchi K, Kori H, Miyachi H, Fujiwara T, Ishidate F, Kageyama R: Oscillatory control of factors determining multipotency and fate in mouse neural progenitors. Science. 2013, 342 (6163): 1203-1208. 10.1126/science.1242366.

    Article  CAS  PubMed  Google Scholar 

  58. Vinals F, Reiriz J, Ambrosio S, Bartrons R, Rosa JL, Ventura F: BMP-2 decreases Mash1 stability by increasing Id1 expression. EMBO J. 2004, 23: 3527-3537. 10.1038/sj.emboj.7600360.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  59. Li S, Mattar P, Zinyk D, Singh K, Chaturvedi CP, Kovach C, Dixit R, Kurrasch DM, Ma YC, Chan JA, Wallace V, Dilworth FJ, Brand M, Schuurmans C: GSK3 temporally regulates neurogenin 2 proneural activity in the neocortex. J Neurosci. 2012, 32: 7791-7805. 10.1523/JNEUROSCI.1309-12.2012.

    Article  CAS  PubMed  Google Scholar 

  60. Welinder E, Mansson R, Mercer EM, Bryder D, Sigvardsson M, Murre C: The transcription factors E2A and HEB act in concert to induce the expression of FOXO1 in the common lymphoid progenitor. Proc Natl Acad Sci U S A. 2011, 108: 17402-17407. 10.1073/pnas.1111766108.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  61. Jones ME, Zhuang Y: Stage-specific functions of E-proteins at the beta-selection and T-cell receptor checkpoints during thymocyte development. Immunol Res. 2011, 49: 202-215. 10.1007/s12026-010-8182-x.

    Article  CAS  PubMed  Google Scholar 

  62. Brill MS, Ninkovic J, Winpenny E, Hodge RD, Ozen I, Yang R, Lepier A, Gascon S, Erdelyi F, Szabo G, Parras C, Guillemot F, Frotscher M, Berninger B, Hevner RF, Raineteau O, Götz M: Adult generation of glutamatergic olfactory bulb interneurons. Nat Neurosci. 2009, 12: 1524-1536. 10.1038/nn.2416.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  63. Winpenny E, Lebel-Potter M, Fernandez ME, Brill MS, Götz M, Guillemot F, Raineteau O: Sequential generation of olfactory bulb glutamatergic neurons by Neurog2-expressing precursor cells. Neural Dev. 2011, 6: 1-18. 10.1186/1749-8104-6-1.

    Article  Google Scholar 

  64. Spiliotopoulos D, Goffredo D, Conti L, Di Febo F, Biella G, Toselli M, Cattaneo E: An optimized experimental strategy for efficient conversion of embryonic stem (ES)-derived mouse neural stem (NS) cells into a nearly homogeneous mature neuronal population. Neurobiol Dis. 2009, 34: 320-331. 10.1016/j.nbd.2009.02.007.

    Article  CAS  PubMed  Google Scholar 

  65. Wilkinson DG, Nieto MA: Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol. 1993, 225: 361-373.

    Article  CAS  PubMed  Google Scholar 

  66. Azim K, Raineteau O, Butt AM: Intraventricular injection of FGF-2 promotes generation of oligodendrocyte-lineage cells in the postnatal and adult forebrain. Glia. 2012, 60: 1977-1990. 10.1002/glia.22413.

    Article  PubMed  Google Scholar 

  67. Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29: e45-10.1093/nar/29.9.e45.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

BF, KA, and AHC were supported by a National Research Project grant (NRP63; 406340_128291) and by a research grant (31003A_127082) from the Swiss National Fund. MF and SR were supported by a grant from the Swiss National Fund (31003A_127082) and by the NCCR project 1, respectively. KA and AHC were also supported by personal grants from the Forschungskredit (K-41211-01-01) of the University of Zurich or from the Mexican Government (CONACYT), respectively.

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Olivier Raineteau.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

BF, KA, SR, and MF carried out the experimental work. AHC contributed expertise for the subcloning of plasmids. BF and OR wrote the manuscript. OR conceived the study. All authors read and approved the final manuscript.

Electronic supplementary material

13064_2014_267_MOESM1_ESM.pdf

Additional file 1: (A) In contrast to the blockade of Ascl1- induced neuronal differentiation shown in Figure 1C, dnE47 overexpression alone did not affect Map2 expression in NS5 cells kept in proliferative culture conditions (100 ± 1.0 vs. 93.9 ± 5.3). (B) Ki67 immunoreactivity revealed an increased non-RGC proliferation after dnE47, when compared to empty control conditions, as shown in Figure 1E. (C & D) Antigenic characterization of Ki67+ non-RGCs, demonstrated that both Ascl1+ type-C (C, Figure 2C) and, to a lesser extent, Dcx+ type-A cells (D, Figure 2C) proliferate. (E–G) Representative immunostainings for detected changes in the expression of cell type specific markers; i.e., RGC = Vimentin+ (E), type-C = Ascl1+ (F), type-A = Dcx+ (G), following dnE47 expression, as quantified in Figure 2D–G. (H) Absence of cross-reactivity between shRNAs against E2A and E2-2 transcripts (see also Figure 4B). E2A mRNA expression was not reduced when shRNA against E2-2 was applied in vitro (100 ± 7.6 vs. 111.5 ± 1.1). Similarly, E2-2 mRNA expression was not reduced when shRNA against E2A was used (100 ± 2.7 vs. 148.6 ± 8.7). (I, J), Representative immunostainings for Dcx and Ascl1 illustrating an increased Dcx expression (I, quantified in Figure 5C) and unaltered Ascl1 expression (J, quantified in Figure 5D), when E2-2 was overexpressed. Arrows identify representative cells for each experimental condition. Quantifications were normalized to control conditions. Scale bars: B–G, I, J, 20 μm. (PDF 3 MB)

Authors’ original submitted files for images

Rights and permissions

Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Fischer, B., Azim, K., Hurtado-Chong, A. et al. E-proteins orchestrate the progression of neural stem cell differentiation in the postnatal forebrain. Neural Dev 9, 23 (2014). https://doi.org/10.1186/1749-8104-9-23

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/1749-8104-9-23

Keywords