Skip to main content

Table 1 Primers used for RT-PCR

From: Cytoplasmic polyadenylation and cytoplasmic polyadenylation element-dependent mRNA regulation are involved in Xenopus retinal axon development

Name Sequence (5'-3') GenBank accession number of gene
xGld2 f TGACCACATAGACACCACTTTGCC AY655140
xGld2 r CGCACCACTGACTTTATCCCTG  
Symplekin f GCTATCTCCAGCATCAACCTTACG BC047265
Symplekin r TGTCCCCCTTCACCATCTTCTC  
PARN f AACACATCCCTTGCCGAACTG 14495248
PARN r GGTAGAGGTCACTGGTCTTCCATTC  
CPEB1 f GCAACTTTGTGCGTAGTCCA NM_001090603
CPEB1 r TCCATAGAGTGCTGCCAGTG  
CPEB2 f CCATCAAAGCAGTGGTTGGAAC BX850448
CPEB2 r GAACGAGTGAACTTGGGTGGTG  
CPEB3 f CAGTCAGTTTGTGGTAAGCAGTCG BJ617668
CPEB3 r ATGGGGACAGAGATGGGGTG  
CPEB4 f CAAAGTCCATCACCAACACCCTC CF547305
CPEB4 r CCATCATCCAGAAATCCATCTTCC  
β-actin f CCTGTGCAGGAAGATCACAT BC041203
β-actin r TGTTAAAGAGAATGAGCCCC