Skip to main content

Table 1 Characteristics of CRISPRs targeting prdm12b, bhlhe22 and nkx6.1

From: Zebrafish prdm12b acts independently of nkx6.1 repression to promote eng1b expression in the neural tube p1 domain

Target gene Start Coordinate Target sequence Enzyme Strand Mutagenesis Ratea Transmission Rateb
prdm12b Chr5:66656496 GCTGGGGGAACACCTGTTCG Taq1α + 1/4 71/92 um318
43/79 um319
bhlhe22 Chr24:25069884 TTCACACACAAAGATCCGGT BstYI 6/14 24/37 um320
nkx6.1 Chr21:17886500 AGTGGAGGATGCTGGTCCAG AvaII 8/12 18/21 um321
  1. aThe fraction of screened F0 animals that carried a mutagenic event
  2. bThe fraction of screened F1 animals that were heterozygous for a mutagenic event