Skip to main content

Table 1 Primers for ISH probes and RT-PCR

From: Postnatal developmental dynamics of cell type specification genes in Brn3a/Pou4f1 Retinal Ganglion Cells

Gene Forward Primer Sequence Reverse Primer Sequence Product Size, bp Incubation (P0-P7), h Incubation (P14-P22), h
For 3’-UTR probes
 Ankrd13b TCCAAGGGCGGAGGCAGGT ATCAGGGAAGGGAAGAGGAAG 821 + (26) 5 6
 Cdh4 AAGTCCCAGCACTGATGAAAAA CACCACCCGAATTGTTTGC 501 + (26) 6 6
 Elfn1 CCTGCGCAAGAAGGTTCAGTT CTTGCTTGCTTGCACCAGGC 367 + (26) 6 6
 Eml1 CACTGTGATTTCTGTTTTGTCTA GCCAGCCTCCCAAAGGGAG 473 + (26) 6 3
 Fam19a4 AACTTTATGAACCTTGGAGAATG TGAAATTGGAGGCAAGATGACT 498 + (26) 6 3
 Foxp2 CTGTGCTGTTAGTGTAAAGATGT GTTGCTTTCTAGAGTGTCATAAC 503 + (26) 3 3
 Gabra1 GTTCTTTTAGTCGTATTCTGTTG GAGCTTGCAAAATAGATTTGCC 900 + (26) 6 6
 Grm4 GCCACACAGGCCTTCCTTCC CTTCGAAACACACTCAAGATTAG 433 + (26) 6 5
 Hpca CCTCTCCCTCGTGTCTATCC GAGCTGGGACAAGAAGTGTTC 443 + (26) 6 3
 Plppr3 CAGTGCCAGCTCCGACTCTT TTGCCAGGCTTAGTCCTGGTA 469 + (26) 6 6
 Mapk10 GTCACAACGCACTCACGAAAG ATCTGTATCTACATCCATCTGAC 364 + (26) 6 5
 Nptx1 GGGGCTGAGAGCTCACTTG ACCACTTCGAGCCACGCTC 600 + (26) 6 5
 Nptx2 TCTCCGTCCCAGAGGCCAC CAGTTCCCTCAGACGGAAAG 486 + (26) 6 6
 Ntrk1 ATCGAGTGTATCACGCAGGGC TATGATGGATGCTGGCCATGAA 328 + (26) 6 5
 Pcdh20 GACGAGTTTCCTACTTCTTGGG TTATCGTTGATGTCCAGAAGAAG 511 + (26) 6 9
 Pick1 ACCACTGTAGGACAGCGAAGG TTATTCAATACAGGCCCAGCTTC 393 + (26) 6 9
 Pip5kl1 ACAAGGTGTGTCGAAGTCGAAG TAAGGGTTGGGGTCAGGGTC 458 + (26) 6 6
 Pnkd CTTCACCATCCTCTTCATCACT GAAGGTGGAAGATAGACTAGCC 360 + (26) 6 6
 Rims1 CACCCTCCTCTGGAGTCCAG TGTGTCTGCAGTTTATACCAATG 500 + (26) 2 3
 Tmem25 TGCCTGTCCCTGTTGTGACC GTACAAAACGATGCAGAGCTAC 687 + (26) 6 6
 Tmem91 CAACAAGGCTTGGGCCAAGG GGGTATCTTTAATTTCTCACATTG 348 + (26) 6 5
 Tshz2 GCAGAAAGAAAGGGAAATATGTG CATCACCTATTTGTTCTCTTCG 418 + (26) 6 6
 Tusc5 CTGGAGATCTCCGAACCTACAT ATGGAGGATTTCCGTATGGCC 492 + (26) 6 5
 Pou4f1 (control) TGTGTAGAAGATCCCCTTTGG GCACAGAAATGGTTCTGATG 519 + (26) 3 3
For transcript-specific probes
 Clcc1 (pr.1 + pr.9) ^ CACAGCTGCGGGCCGAGC CTGAGATTTCCTCATCGTTCCT 208 + (26)   
 Clcc1 (pr.2 + pr.9) AGTCCGCTCGGGACTCCAG CTGAGATTTCCTCATCGTTCCT 181/252 + (26) 7 7
 Clcc1 (pr.3 + pr.9) ^ TGTTTGAGGTAGGCGGCTCG CTGAGATTTCCTCATCGTTCCT 220 + (26)   
 Clcc1 (pr.4 + pr.9) ^ TCGGCGTCTTCCGCGGCC CTGAGATTTCCTCATCGTTCCT 203 + (26)   
 Clcc1 (pr.5 + pr.9) ^ TCCCTCTGAAAGAGCAGGCAG CTGAGATTTCCTCATCGTTCCT 172 + (26)   
 Clcc1 (pr.6 + pr.9) ^* TGAGTGGGCGCTCTTCGGTG CTGAGATTTCCTCATCGTTCCT 293 + (26)   
 Clcc1 (pr.7 + pr.9) ^ CGTTTCCAGGATACACCGAGA CTGAGATTTCCTCATCGTTCCT 300 + (26)   
 Clcc1 (pr.2 + pr.8) ^* AGTCCGCTCGGGACTCCAG CGGGTTAAGGGAAGTCAAATTC 199/270 + (26)   
 Clcc1(pr.7 + pr.8) ^^ CGTTTCCAGGATACACCGAGA CGGGTTAAGGGAAGTCAAATTC 159 + (26) 4 3
 Clcc1(pr.10 + pr.11)^ GTGAGGTCTGGAACATCAGAG CATAAACACATTATATGGATCTA 432 + (26)   
 Pnkd (pr.1 + pr.2) TGGGACCCGAACATGGCGG GGCTAGCCCCACGGCTTTC 246 (+  26) 2 3
 Pnkd (pr.3 + pr.4) * TGTGGTATCCTCTTCTTCGTC CTCCTTCCACGGTGTGGAAG 289 + (26) 2 3
 Pnkd (pr.5 + pr.6) CCCAGCATGGCTTGGCAGG CCGATTCGGAAGAGCAGCCG 167 (+  26) 2 3
 Pnkd (pr.5 + pr.7) ^ CCCAGCATGGCTTGGCAGG ATTGAAGAGGCGGGGCTGAG 282 (+  26)   
  1. Left column represents gene name, or gene name together with primer combination for transcript-specific probes. Second and third columns show primer sequences, fourth column shows product length, fifth and sixth columns represent ISH probe incubation times for P0-P7 and P14-P22 retinas. Some of the primer combinations could give rise to two different DNA fragments depending on splice variants. ^ - primer combination used for RT-PCR not ISH. ^^ - primer combination used for ISH not RT-PCR. * - primer combination gave negative result in RT-PCR. Primer combinations pr.3 + pr.8, pr.4 + pr.8, pr.6 + pr.8 for Clcc1 not shown in this table also gave negative results (for predicted fragment sizes see Table 2). Numbers in parenthesis refer to T3 promoter extension, as required for ISH probe generation