Skip to main content

Table 3 Primers used for ChIP

From: The methyl binding domain 3/nucleosome remodelling and deacetylase complex regulates neural cell fate determination and terminal differentiation in the cerebral cortex

Primer name Sequence (5′ to 3′)
Nhlh1 -455 F AGGGAGGACCTTCAGGTTAC
Nhlh1 -455R TTTCATTCTGAGTCCCAGCG
Nhlh1 -298 F TGCTACCTCTAGTGTGGGAG
Nhlh1 -298R AATAGAGAGCTGGGGAAGGG
Nhlh1 145 F CCCTTTTGCCTAGGCCTTAC
Nhlh1 145R CTCAAGGGTCATCTGTCTGC
Nhlh1 314 F GACAGATGACCCTTGAGCAG
Nhlh1 314R ATGCTGCCCAAAGAATCCAA
Nhlh1 871 F ACATGGATGGGAAATGCTCC
Nhlh1 871R CACCAGCATCTGACACCTAC
Nhlh1 1522 F GAGGCTGAGGGATTGTGAAG
Nhlh1 1522R CCTTCTGCACCCTTGTTTCT
Nhlh1 2906 F TGTCTCGAAGGACTTCACCT
Nhlh1 2906R AGCCGAACTTGGCTTCATAG
Nhlh1 3683 F CTCCTACCTGAACCATGTGC
Nhlh1 3683R AGGGAAATGGGGAGAATCCA
Nhlh2 -4520 F CGATGCCTCAACACATACCA
Nhlh2 -4520R TACCCACTCACAGACACACT
Nhlh2 -824 F TTTGGGACTGGAGGTCATCT
Nhlh2 -824R CCCATCCTAACACGTGAGTG
Nhlh2 418 F AGAGGCAACCTTAAGCCCTA
Nhlh2 418R GGGACGATTCCTCCACTTTC
Nhlh2 2907 F GAGCTCCGCAAACTACTACC
Nhlh2 2907R TCAAGTGTCTCTGGGCAAAC
Nhlh2 4798 F CCAGCCTGGGATGGTATAGA
Nhlh2 4798R CTCCTTAGCCCCGAGTTTTC
NeuroD1 -1150 F AACCATTCCTCCTCCTCCTC
NeuroD1 -1150R CTGTTTCCCTTTCTGGGGAC
NeuroD1 -619 F AAGGTTGAGTCAAGGCTGTG
NeuroD1 -619R GGTGGCTGGCTTCTAATCTC
NeuroD1 -338 F AAGCAGTCTTCAGGCTAGGA
NeuroD1 -338R ATTAACCCTTTGTGGCAGCA
NeuroD1 328 F ATTTGTGGAGTCGGTTGTCC
NeuroD1 328R GAGTGCTGGGACTCATTACG
NeuroD1 830 F TGCTACCTGTTACTGTCCCA
NeuroD1 830R GGCTTTTCAAAGTTCGCCTC
NeuroD1 1450 F GTGAGTTGGGAGTGACTTGG
NeuroD1 1450R GTCCACTGCAAAATGGATGC
NeuroD1 2258 F AATAGAGACACTGCGCTTGG
NeuroD1 2258R CAGGGGACTGGTAGGAGTAG
NeuroD1 2658 F TGCCTTTACCATGCACTACC
NeuroD1 2658R GTTGTCTATGGGGATCTCGC
NeuroD1 4271 F AGCTTGTCCTGTGCTTAGTC
NeuroD1 4271R TAAAACAGAGGCGAGGTCTG
NeuroD2 -1838 F GACTTCCTAGTTGCAGAGCC
NeuroD2 -1838R GAAAGAAGGTCCAAAGGCCA
NeuroD2 -450 F GGTGCCAGCATCTACCTATG
NeuroD2 -450R CATTTCCCTGTCTCCAGGTC
NeuroD2 428 F CCGTGTTCTCTCTCCCATTG
NeuroD2 428R GTGGGAAAAGGTCACAGGTT
NeuroD2 1388 F CACTCTGTGCTGTCTGTCTC
NeuroD2 1388R GGATCTCTTCTCCTCCACGA
NeuroD2 3082 F CACCCTAACACGAATCTCCG
NeuroD2 3082R ATGCGTTTTCTCTCCGATCC