Skip to main content

Table 2 Primers used for gene expression analyses

From: The methyl binding domain 3/nucleosome remodelling and deacetylase complex regulates neural cell fate determination and terminal differentiation in the cerebral cortex

Sequence (5′ to 3′) Gene
TTGACTGCCGAGAAGTTGTG Ctnnb1
CTGGCATTTTGGAGAGGAAG Ctnnb1
TTTCTCCAACCTCCAGATCC Gfap
CCCGCATCTCCACAGTCTT Gfap
AAAGACCTGCAGCACTTGAG Nhlh1
TCCAGCACATGGTTCAGGTA Nhlh1
GTGTCGGACCTAGAGCCAGT Nhlh2
CAGGTTGAAAGCCTCCACTC Nhlh2
TGGGTCTTGGAGTAGCAAGG NeuroD1
GGAGGAGGAGGATCAAAAGC NeuroD1
CGAAGAAACGCAAGATGACC NeuroD2
TTCTGCGTCTTGGAGTAGCA NeuroD2
ACCCCGGGAAAGAGAATCTA NeuroD4
TCCACCATGTCCTTGGATTT NeuroD4
GGACACTGAAGCCAGAGAGG S100β
TTCAGCTTGTGCTTGTCACC S100β
CACGGGGGCCTGTCTCCAGA Ppia
GTCAGGCACGTCTGTGGGCC Ppia