Skip to main content

Table 1 Primer sequences used for RT-PCR, q PCR and ChIP

From: Neurotrophin/Trk receptor signaling mediates C/EBPα, -β and NeuroD recruitment to immediate-early gene promoters in neuronal cells and requires C/EBPs to induce immediate-early gene transcription

  Gene Sense Antisense
RT-PCR Cebpa aaggccaagaagtcggtgga cagttcacggctcagctgtt
  Cebpb gcgcgagcgcaacaacatc tgcttgaacaagttccgcag
  Neurod tcaaccctcggactttcttg gcagtcagttagggggcttt
  Ubiquitin tggctattaattattcggtctgcat gcaagtggctagagtgcagagtaa
qPCR Egr1 gttatcccagccaaacgactc ggttcaggccacaaagtgtt
  Fos cccatccttacggactccc gagatagctgctctactttgcc
  Egr2 ggaccacctctactctccg tgggatcataggaatgagacctg
  Cebpa gtcactggtcaactccagcac caagaacagcaacgagtaccg
  Cebpb ggagacgcagcacaaggt agctgcttgaacaagttccg
  Neurod atgaccaaatcatacagcgagag tctgcctcgtgttcctcgt
  MAP2A/B aaagttgcctccagttccattt tctttgattccgtgggcattt
  gapdh aactttggcattgtggaagg acacattgggggtaggaaca
ChIP Promoter Egr1 tgcccaccactcttggatgg ttcaagggtctggaacagca
  CD Egr1 gttatcccagccaaacgactc ggttcaggccacaaagtgtt
  Promoter Fos gctcgccttctctgcctttc gcgctctgtcgtcaactcta
  Promoter Fos* tccctccctcctttacacag cccgtcttggcatacatctt
  3' UTR Fos ggctacactgtgagatccta acaactgccagggccattag
  Promoter Egr2 gccctgttcctcagtccata gccaggagttgctggtgtag
  CD Egr2 ggaccacctctactctccg tgggatcataggaatgagacctg
  1. For the ChIP experiments the same primers were used for both PCR and qPCR except where noted. *Additional primers used for Fos qPCR after ChIP. CD, coding region; UTR, untranslated region.